Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 69698158
total bases: 10524421858
Q20 bases: 10205882245(96.9733%)
Q30 bases: 9760201982(92.7386%)

Read2 before filtering:
total reads: 69698158
total bases: 10524421858
Q20 bases: 10227194813(97.1758%)
Q30 bases: 9678863014(91.9657%)

Read1 after filtering:
total reads: 67466119
total bases: 7828100320
Q20 bases: 7795437846(99.5828%)
Q30 bases: 7644331064(97.6524%)

Read2 after filtering:
total reads: 67466119
total bases: 7842679826
Q20 bases: 7784766101(99.2616%)
Q30 bases: 7585804734(96.7247%)

Filtering result:
reads passed filter: 134932238
reads failed due to low quality: 2915828
reads failed due to too many N: 4466
reads failed due to too short: 1543784
reads with adapter trimmed: 103983654
bases trimmed due to adapters: 4788453038

Duplication rate: 54.6807%

Insert size peak (evaluated by paired-end reads): 98

JSON report: 659_bCu-T1-TRNA-1_B23WHTKLT4_1.fastp.json
HTML report: 659_bCu-T1-TRNA-1_B23WHTKLT4_1.fastp.html

fastp --in1 659_bCu-T1-TRNA-1_B23WHTKLT4_1_1.fastq.gz --in2 659_bCu-T1-TRNA-1_B23WHTKLT4_1_2.fastq.gz --out1 659_bCu-T1-TRNA-1_B23WHTKLT4_1_1.fastp.fastq.gz --out2 659_bCu-T1-TRNA-1_B23WHTKLT4_1_2.fastp.fastq.gz --json 659_bCu-T1-TRNA-1_B23WHTKLT4_1.fastp.json --html 659_bCu-T1-TRNA-1_B23WHTKLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 158 seconds