Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 104202847
total bases: 15734629897
Q20 bases: 15296193973(97.2136%)
Q30 bases: 14684162750(93.3239%)

Read2 before filtering:
total reads: 104202847
total bases: 15734629897
Q20 bases: 15374665096(97.7123%)
Q30 bases: 14628367942(92.9693%)

Read1 after filtering:
total reads: 102160001
total bases: 11848462291
Q20 bases: 11804014296(99.6249%)
Q30 bases: 11587818901(97.8002%)

Read2 after filtering:
total reads: 102160001
total bases: 11863259702
Q20 bases: 11786823200(99.3557%)
Q30 bases: 11507372638(97.0001%)

Filtering result:
reads passed filter: 204320002
reads failed due to low quality: 2735648
reads failed due to too many N: 6806
reads failed due to too short: 1343238
reads with adapter trimmed: 162118096
bases trimmed due to adapters: 7220783607

Duplication rate: 54.5139%

Insert size peak (evaluated by paired-end reads): 107

JSON report: 659_dm4-T1-TRNA-1_B23WHTKLT4_1.fastp.json
HTML report: 659_dm4-T1-TRNA-1_B23WHTKLT4_1.fastp.html

fastp --in1 659_dm4-T1-TRNA-1_B23WHTKLT4_1_1.fastq.gz --in2 659_dm4-T1-TRNA-1_B23WHTKLT4_1_2.fastq.gz --out1 659_dm4-T1-TRNA-1_B23WHTKLT4_1_1.fastp.fastq.gz --out2 659_dm4-T1-TRNA-1_B23WHTKLT4_1_2.fastp.fastq.gz --json 659_dm4-T1-TRNA-1_B23WHTKLT4_1.fastp.json --html 659_dm4-T1-TRNA-1_B23WHTKLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 214 seconds