Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 221885781
total bases: 33504752931
Q20 bases: 32880998702(98.1383%)
Q30 bases: 31801161426(94.9154%)

Read2 before filtering:
total reads: 221885781
total bases: 33504752931
Q20 bases: 32822637636(97.9641%)
Q30 bases: 31451366358(93.8714%)

Read1 after filtering:
total reads: 218172944
total bases: 27291252999
Q20 bases: 27185819302(99.6137%)
Q30 bases: 26675368098(97.7433%)

Read2 after filtering:
total reads: 218172944
total bases: 27315344974
Q20 bases: 27139677130(99.3569%)
Q30 bases: 26494317530(96.9943%)

Filtering result:
reads passed filter: 436345888
reads failed due to low quality: 7019038
reads failed due to too many N: 15808
reads failed due to too short: 390828
reads with adapter trimmed: 272564463
bases trimmed due to adapters: 11396539724

Duplication rate: 44.1173%

Insert size peak (evaluated by paired-end reads): 109

JSON report: 659_buD-T1-TRNA-1_B23WHTKLT4_1.fastp.json
HTML report: 659_buD-T1-TRNA-1_B23WHTKLT4_1.fastp.html

fastp --in1 659_buD-T1-TRNA-1_B23WHTKLT4_1_1.fastq.gz --in2 659_buD-T1-TRNA-1_B23WHTKLT4_1_2.fastq.gz --out1 659_buD-T1-TRNA-1_B23WHTKLT4_1_1.fastp.fastq.gz --out2 659_buD-T1-TRNA-1_B23WHTKLT4_1_2.fastp.fastq.gz --json 659_buD-T1-TRNA-1_B23WHTKLT4_1.fastp.json --html 659_buD-T1-TRNA-1_B23WHTKLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 491 seconds