Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44841066230(98.9869%)
Q30 bases: 43654377863(96.3673%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44417436470(98.0517%)
Q30 bases: 42615779204(94.0746%)

Read1 after filtering:
total reads: 295822882
total bases: 38479563741
Q20 bases: 38336897336(99.6292%)
Q30 bases: 37654846533(97.8567%)

Read2 after filtering:
total reads: 295822882
total bases: 38502409196
Q20 bases: 38257721403(99.3645%)
Q30 bases: 37350776624(97.0089%)

Filtering result:
reads passed filter: 591645764
reads failed due to low quality: 7776462
reads failed due to too many N: 23634
reads failed due to too short: 554140
reads with adapter trimmed: 330372687
bases trimmed due to adapters: 12462612046

Duplication rate: 57.3445%

Insert size peak (evaluated by paired-end reads): 119

JSON report: 659_cIX-T1-TRNA-1_B23WHTKLT4_1.fastp.json
HTML report: 659_cIX-T1-TRNA-1_B23WHTKLT4_1.fastp.html

fastp --in1 659_cIX-T1-TRNA-1_B23WHTKLT4_1_1.fastq.gz --in2 659_cIX-T1-TRNA-1_B23WHTKLT4_1_2.fastq.gz --out1 659_cIX-T1-TRNA-1_B23WHTKLT4_1_1.fastp.fastq.gz --out2 659_cIX-T1-TRNA-1_B23WHTKLT4_1_2.fastp.fastq.gz --json 659_cIX-T1-TRNA-1_B23WHTKLT4_1.fastp.json --html 659_cIX-T1-TRNA-1_B23WHTKLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 736 seconds