Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44563846726(98.3749%)
Q30 bases: 43178164120(95.316%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44418468206(98.054%)
Q30 bases: 42662421394(94.1775%)

Read1 after filtering:
total reads: 294936328
total bases: 37557019925
Q20 bases: 37410530544(99.61%)
Q30 bases: 36699723376(97.7173%)

Read2 after filtering:
total reads: 294936328
total bases: 37584906886
Q20 bases: 37345636912(99.3634%)
Q30 bases: 36465027127(97.0204%)

Filtering result:
reads passed filter: 589872656
reads failed due to low quality: 9577198
reads failed due to too many N: 24184
reads failed due to too short: 525962
reads with adapter trimmed: 350703708
bases trimmed due to adapters: 14072350147

Duplication rate: 53.3252%

Insert size peak (evaluated by paired-end reads): 109

JSON report: 659_cTi-T1-TRNA-1_B23WHTKLT4_1.fastp.json
HTML report: 659_cTi-T1-TRNA-1_B23WHTKLT4_1.fastp.html

fastp --in1 659_cTi-T1-TRNA-1_B23WHTKLT4_1_1.fastq.gz --in2 659_cTi-T1-TRNA-1_B23WHTKLT4_1_2.fastq.gz --out1 659_cTi-T1-TRNA-1_B23WHTKLT4_1_1.fastp.fastq.gz --out2 659_cTi-T1-TRNA-1_B23WHTKLT4_1_2.fastp.fastq.gz --json 659_cTi-T1-TRNA-1_B23WHTKLT4_1.fastp.json --html 659_cTi-T1-TRNA-1_B23WHTKLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 854 seconds