Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 278320689
total bases: 42026424039
Q20 bases: 41323569969(98.3276%)
Q30 bases: 40059110776(95.3189%)

Read2 before filtering:
total reads: 278320689
total bases: 42026424039
Q20 bases: 41236222659(98.1198%)
Q30 bases: 39593239816(94.2103%)

Read1 after filtering:
total reads: 273881992
total bases: 35216598790
Q20 bases: 35074983819(99.5979%)
Q30 bases: 34399689507(97.6803%)

Read2 after filtering:
total reads: 273881992
total bases: 35240850962
Q20 bases: 35004331925(99.3288%)
Q30 bases: 34143638106(96.8865%)

Filtering result:
reads passed filter: 547763984
reads failed due to low quality: 7984574
reads failed due to too many N: 20878
reads failed due to too short: 871942
reads with adapter trimmed: 321189599
bases trimmed due to adapters: 12376120845

Duplication rate: 58.8348%

Insert size peak (evaluated by paired-end reads): 119

JSON report: 659_bQZ-T1-TRNA-1_B23WHTKLT4_1.fastp.json
HTML report: 659_bQZ-T1-TRNA-1_B23WHTKLT4_1.fastp.html

fastp --in1 659_bQZ-T1-TRNA-1_B23WHTKLT4_1_1.fastq.gz --in2 659_bQZ-T1-TRNA-1_B23WHTKLT4_1_2.fastq.gz --out1 659_bQZ-T1-TRNA-1_B23WHTKLT4_1_1.fastp.fastq.gz --out2 659_bQZ-T1-TRNA-1_B23WHTKLT4_1_2.fastp.fastq.gz --json 659_bQZ-T1-TRNA-1_B23WHTKLT4_1.fastp.json --html 659_bQZ-T1-TRNA-1_B23WHTKLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 867 seconds