MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-05-28, 01:58 UTC based on data in: /tmp/nxf.BJGLFg3uJl

General Statistics

Showing ⁴⁸⁰/₄₈₀ rows and ⁵⁵/₆₂ columns.

Sample Name	RNA contaminated	RNA contamination %	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	Total Reads	Expected Distinct	Reads	Frac Unmapped	Frac Dupes	Unique Reads	Frac Reads On Target	Frac Pairs On Target	Frac Reads Off Target	Frac Pairs Off Target	Reads On Target	Pairs On Target	Reads Off Target	Pairs Off Target	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	N Q30	GC Bias	Frag Length	% Aligned	M Aligned	Insert Size	Mean Insert Size	Duplication	rRNA	mRNA	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
659_6i-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	130.1bp	123.0bp	0.01%	1.34%	0.39%	0.00%	0.01%	4.11%	0.63%	0.00%	9999000000	44219233	197033624	0.01%	0.78%	43962777	0.87%	0.91%	0.10%	0.09%	38465623	19362188	4338568	1911962	60.67	27.00	0.48%	0.17%	0.98	0.000				132bp	213bp	78.1%	0.0%	96.5%	88.7%	95.5%	94.1M	54.7%	97.5%	23589.8Mb	197.0M	54.7%	98.5%	70.4%
659_6i-T1-TRNA-1_B23WHTKLT4_1_1																																	130.1bp	97.6%	96.2M																89.4%	53%	151bp	151bp	18%	195.4M
659_6i-T1-TRNA-1_B23WHTKLT4_1_2																																																			88.2%	54%	151bp	151bp	18%	195.4M
659_6i-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			83.7%	54%	123bp	127bp	9%	98.5M	83.7%	54%	123bp	127bp	9%	98.5M
659_6i-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			83.7%	54%	123bp	127bp	9%	98.5M	83.7%	54%	123bp	127bp	9%	98.5M
659_Dl-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	136.2bp	127.0bp	0.01%	1.43%	0.42%	0.00%	0.01%	4.63%	0.71%	0.00%	9999000000	35339801	196480834	0.01%	0.85%	29022325	0.82%	0.88%	0.13%	0.12%	23765724	11975584	3848991	1709226	38.74	15.00	0.35%	0.09%	0.97	0.000				140bp	231bp	85.8%	0.0%	96.6%	85.1%	94.4%	92.7M	60.4%	97.3%	23926.6Mb	196.5M	56.1%	98.2%	65.5%
659_Dl-T1-TRNA-1_B23WHTKLT4_1_1																																	136.2bp	97.1%	95.4M																90.5%	55%	151bp	151bp	18%	153.1M
659_Dl-T1-TRNA-1_B23WHTKLT4_1_2																																																			89.3%	55%	151bp	151bp	18%	153.1M
659_Dl-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			87.6%	55%	125bp	132bp	9%	98.2M	87.6%	55%	125bp	132bp	9%	98.2M
659_Dl-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			87.4%	56%	125bp	132bp	9%	98.2M	87.4%	56%	125bp	132bp	9%	98.2M
659_Lx-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	129.8bp	120.0bp	0.01%	1.08%	0.36%	0.00%	0.01%	3.48%	0.60%	0.00%	9999000000	73591466	196630880	0.00%	0.62%	75294628	0.93%	0.95%	0.06%	0.05%	70122784	35285647	4332948	1745161	116.26	47.00	0.58%	0.33%	0.98	0.000				131bp	261bp	62.0%	0.0%	97.9%	90.7%	96.2%	94.6M	38.9%	97.5%	23118.2Mb	196.6M	54.3%	98.3%	70.4%
659_Lx-T1-TRNA-1_B23WHTKLT4_1_1																																	129.8bp	98.4%	96.7M																88.2%	53%	151bp	151bp	18%	252.5M
659_Lx-T1-TRNA-1_B23WHTKLT4_1_2																																																			87.2%	54%	151bp	151bp	18%	252.5M
659_Lx-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			79.1%	54%	120bp	122bp	18%	98.3M	79.1%	54%	120bp	122bp	18%	98.3M
659_Lx-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			79.7%	54%	121bp	122bp	9%	98.3M	79.7%	54%	121bp	122bp	9%	98.3M
659_Mt-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	139.8bp	130.0bp	0.00%	0.84%	0.30%	0.00%	0.01%	2.74%	0.50%	0.00%	9999000000	39946214	196243926	0.01%	0.80%	39510342	0.87%	0.91%	0.10%	0.09%	34403780	17340568	4003098	1699144	58.76	23.00	0.44%	0.15%	0.97	0.000				149bp	273bp	80.3%	0.0%	96.9%	86.5%	94.9%	93.1M	56.8%	97.4%	24206.0Mb	196.2M	55.1%	98.1%	61.4%
659_Mt-T1-TRNA-1_B23WHTKLT4_1_1																																	139.8bp	97.5%	95.6M																89.9%	54%	151bp	151bp	27%	167.9M
659_Mt-T1-TRNA-1_B23WHTKLT4_1_2																																																			88.3%	55%	151bp	151bp	27%	167.9M
659_Mt-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			85.9%	54%	127bp	132bp	9%	98.1M	85.9%	54%	127bp	132bp	9%	98.1M
659_Mt-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			85.8%	55%	127bp	137bp	18%	98.1M	85.8%	55%	127bp	137bp	18%	98.1M
659_bCu-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	122.2bp	114.0bp	0.00%	0.68%	0.24%	0.00%	0.00%	2.26%	0.40%	0.00%	9999000000	16041081	134932238	0.01%	0.91%	12624538	0.72%	0.80%	0.20%	0.20%	9072505	4535875	2522077	1160273	13.35	3.00	0.10%	0.02%	0.97	0.000				120bp	175bp	91.3%	0.0%	96.4%	86.6%	94.9%	64.1M	54.7%	97.2%	15230.1Mb	134.9M	59.2%	96.8%	74.6%
659_bCu-T1-TRNA-1_B23WHTKLT4_1_1																																	122.2bp	97.2%	65.6M																91.3%	57%	151bp	151bp	18%	69.7M
659_bCu-T1-TRNA-1_B23WHTKLT4_1_2																																																			89.2%	58%	151bp	151bp	27%	69.7M
659_bCu-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			91.3%	59%	116bp	117bp	9%	67.5M	91.3%	59%	116bp	117bp	9%	67.5M
659_bCu-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			90.8%	59%	116bp	117bp	9%	67.5M	90.8%	59%	116bp	117bp	9%	67.5M
659_bGW-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	144.1bp	132.0bp	0.01%	1.28%	0.66%	0.00%	0.02%	4.10%	0.98%	0.00%	9999000000	87574990	197077324	0.00%	0.54%	90851274	0.94%	0.97%	0.05%	0.03%	85726643	43330762	4168912	1402901	160.60	59.00	0.60%	0.39%	0.98	0.000				176bp	399bp	54.2%	0.0%	98.2%	89.0%	95.7%	94.3M	36.3%	97.5%	24661.8Mb	197.1M	56.8%	98.5%	58.0%
659_bGW-T1-TRNA-1_B23WHTKLT4_1_1																																	144.1bp	98.4%	97.0M																91.6%	55%	151bp	151bp	18%	470.6M
659_bGW-T1-TRNA-1_B23WHTKLT4_1_2																																																			90.5%	56%	151bp	151bp	18%	470.6M
659_bGW-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			78.5%	56%	128bp	137bp	18%	98.5M	78.5%	56%	128bp	137bp	18%	98.5M
659_bGW-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			79.2%	57%	128bp	137bp	9%	98.5M	79.2%	57%	128bp	137bp	9%	98.5M
659_bGc-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	136.2bp	125.0bp	0.00%	0.97%	0.39%	0.00%	0.01%	2.94%	0.59%	0.00%	9999000000	53890842	196374780	0.01%	0.71%	57435585	0.91%	0.94%	0.07%	0.06%	52285208	26377288	4087586	1608960	89.72	37.00	0.54%	0.25%	0.97	0.000				143bp	288bp	71.1%	0.0%	97.3%	90.4%	96.1%	94.3M	45.9%	97.3%	23655.6Mb	196.4M	56.3%	98.2%	64.5%
659_bGc-T1-TRNA-1_B23WHTKLT4_1_1																																	136.2bp	98.1%	96.3M																88.6%	55%	151bp	151bp	18%	194.5M
659_bGc-T1-TRNA-1_B23WHTKLT4_1_2																																																			87.1%	56%	151bp	151bp	18%	194.5M
659_bGc-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			82.4%	56%	124bp	132bp	9%	98.2M	82.4%	56%	124bp	132bp	9%	98.2M
659_bGc-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			82.4%	56%	124bp	132bp	9%	98.2M	82.4%	56%	124bp	132bp	9%	98.2M
659_bNS-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	154.0bp	139.0bp	0.00%	1.46%	0.56%	0.00%	0.01%	4.35%	0.85%	0.00%	9999000000	67262945	197061868	0.01%	0.61%	76796697	0.93%	0.96%	0.06%	0.04%	71481433	36248879	4312641	1430151	138.99	54.00	0.60%	0.36%	0.97	0.000				205bp	514bp	61.3%	0.0%	97.7%	90.6%	96.1%	94.7M	42.8%	97.4%	25260.6Mb	197.1M	56.3%	98.5%	51.7%
659_bNS-T1-TRNA-1_B23WHTKLT4_1_1																																	154.0bp	98.3%	96.8M																91.0%	55%	151bp	151bp	18%	341.4M
659_bNS-T1-TRNA-1_B23WHTKLT4_1_2																																																			89.9%	56%	151bp	151bp	18%	341.4M
659_bNS-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			80.4%	55%	132bp	147bp	18%	98.5M	80.4%	55%	132bp	147bp	18%	98.5M
659_bNS-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			81.1%	56%	132bp	147bp	9%	98.5M	81.1%	56%	132bp	147bp	9%	98.5M
659_bQZ-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	145.4bp	133.0bp	0.00%	1.47%	0.57%	0.00%	0.01%	4.40%	0.88%	0.00%	9999000000	62628567	196831438	0.01%	0.64%	70535985	0.92%	0.96%	0.06%	0.04%	65072703	32900206	4151643	1512244	120.79	46.00	0.58%	0.32%	0.97	0.000				170bp	353bp	64.6%	0.0%	97.3%	88.5%	95.3%	93.8M	43.5%	97.3%	24666.4Mb	196.8M	57.3%	98.4%	57.5%
659_bQZ-T1-TRNA-1_B23WHTKLT4_1_1																																	145.4bp	97.9%	96.3M																89.9%	56%	151bp	151bp	18%	278.3M
659_bQZ-T1-TRNA-1_B23WHTKLT4_1_2																																																			88.6%	57%	151bp	151bp	18%	278.3M
659_bQZ-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			80.3%	57%	129bp	137bp	18%	98.4M	80.3%	57%	129bp	137bp	18%	98.4M
659_bQZ-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			80.7%	57%	129bp	142bp	9%	98.4M	80.7%	57%	129bp	142bp	9%	98.4M
659_bTo-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	160.9bp	145.0bp	0.00%	0.75%	0.68%	0.00%	0.01%	2.44%	1.02%	0.00%	9999000000	123795419	197402488	0.00%	0.46%	106908385	0.95%	0.98%	0.04%	0.02%	101768903	51526184	4332011	1254488	210.64	67.00	0.61%	0.43%	0.97	0.000				246bp	653bp	46.0%	0.0%	98.2%	92.6%	96.8%	95.6M	31.5%	97.3%	25757.2Mb	197.4M	55.9%	98.7%	47.4%
659_bTo-T1-TRNA-1_B23WHTKLT4_1_1																																	160.9bp	98.5%	97.3M																90.6%	55%	151bp	151bp	18%	434.3M
659_bTo-T1-TRNA-1_B23WHTKLT4_1_2																																																			89.5%	56%	151bp	151bp	18%	434.3M
659_bTo-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			78.2%	55%	134bp	151bp	18%	98.7M	78.2%	55%	134bp	151bp	18%	98.7M
659_bTo-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			79.0%	56%	134bp	151bp	9%	98.7M	79.0%	56%	134bp	151bp	9%	98.7M
659_bUW-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	161.4bp	145.0bp	0.01%	1.63%	0.65%	0.00%	0.01%	4.98%	0.99%	0.00%	9999000000	158027135	197388136	0.00%	0.41%	116255352	0.95%	0.98%	0.04%	0.02%	110668208	56061862	4672094	1355144	229.81	76.00	0.61%	0.46%	0.98	0.000				223bp	633bp	41.3%	0.0%	98.4%	86.1%	94.3%	93.0M	27.5%	97.6%	25670.8Mb	197.4M	54.3%	98.7%	48.2%
659_bUW-T1-TRNA-1_B23WHTKLT4_1_1																																	161.4bp	98.6%	97.3M																91.6%	53%	151bp	151bp	18%	617.4M
659_bUW-T1-TRNA-1_B23WHTKLT4_1_2																																																			90.7%	54%	151bp	151bp	18%	617.4M
659_bUW-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			77.1%	53%	133bp	151bp	18%	98.7M	77.1%	53%	133bp	151bp	18%	98.7M
659_bUW-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			78.4%	54%	133bp	151bp	9%	98.7M	78.4%	54%	133bp	151bp	9%	98.7M
659_bhK-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	157.5bp	142.0bp	0.00%	0.68%	0.37%	0.00%	0.01%	2.53%	0.65%	0.00%	9999000000	81502653	197277214	0.01%	0.58%	81980265	0.94%	0.97%	0.05%	0.03%	76813475	38915360	4164541	1364634	154.65	58.00	0.60%	0.38%	0.98	0.000				244bp	621bp	58.7%	0.0%	97.6%	92.5%	96.8%	95.4M	40.0%	97.4%	25533.2Mb	197.3M	56.3%	98.6%	49.1%
659_bhK-T1-TRNA-1_B23WHTKLT4_1_1																																	157.5bp	98.3%	97.0M																92.3%	55%	151bp	151bp	18%	481.3M
659_bhK-T1-TRNA-1_B23WHTKLT4_1_2																																																			91.0%	56%	151bp	151bp	18%	481.3M
659_bhK-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			80.1%	56%	133bp	151bp	18%	98.6M	80.1%	56%	133bp	151bp	18%	98.6M
659_bhK-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			80.6%	56%	133bp	151bp	9%	98.6M	80.6%	56%	133bp	151bp	9%	98.6M
659_buD-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	140.1bp	127.0bp	0.01%	1.19%	0.61%	0.00%	0.02%	3.66%	0.92%	0.00%	9999000000	103944763	196669276	0.01%	0.49%	99664429	0.94%	0.96%	0.05%	0.04%	93459517	47190586	5070782	1813404	170.64	78.00	0.65%	0.45%	0.97	0.000				161bp	378bp	49.6%	0.0%	97.6%	90.1%	95.9%	94.3M	31.2%	97.4%	23996.5Mb	196.7M	54.3%	98.3%	61.2%
659_buD-T1-TRNA-1_B23WHTKLT4_1_1																																	140.1bp	98.2%	96.6M																85.3%	53%	151bp	151bp	18%	221.9M
659_buD-T1-TRNA-1_B23WHTKLT4_1_2																																																			84.3%	54%	151bp	151bp	18%	221.9M
659_buD-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			76.8%	54%	125bp	132bp	18%	98.3M	76.8%	54%	125bp	132bp	18%	98.3M
659_buD-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			77.4%	54%	125bp	132bp	9%	98.3M	77.4%	54%	125bp	132bp	9%	98.3M
659_bua-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	148.0bp	137.0bp	0.00%	0.71%	0.54%	0.00%	0.01%	2.32%	0.81%	0.00%	9999000000	64192526	197371230	0.00%	0.62%	75198506	0.93%	0.96%	0.06%	0.04%	69909250	35349711	4380592	1594559	132.47	44.00	0.56%	0.34%	0.97	0.000				182bp	421bp	62.2%	0.0%	97.3%	91.7%	96.5%	95.3M	42.1%	97.3%	25115.2Mb	197.4M	55.1%	98.7%	55.5%
659_bua-T1-TRNA-1_B23WHTKLT4_1_1																																	148.0bp	98.1%	96.8M																89.1%	54%	151bp	151bp	18%	268.6M
659_bua-T1-TRNA-1_B23WHTKLT4_1_2																																																			87.9%	55%	151bp	151bp	18%	268.6M
659_bua-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			79.8%	54%	131bp	142bp	18%	98.7M	79.8%	54%	131bp	142bp	18%	98.7M
659_bua-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			80.1%	55%	131bp	142bp	9%	98.7M	80.1%	55%	131bp	142bp	9%	98.7M
659_c95-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	155.5bp	140.0bp	0.01%	1.07%	0.45%	0.00%	0.01%	3.35%	0.69%	0.00%	9999000000	152202638	197201846	0.01%	0.42%	114769242	0.94%	0.97%	0.05%	0.03%	108217193	54805803	5545107	1825579	215.86	94.00	0.66%	0.49%	0.98	0.000				199bp	483bp	42.0%	0.0%	97.5%	89.3%	95.9%	94.5M	28.0%	97.5%	25187.5Mb	197.2M	54.7%	98.6%	51.5%
659_c95-T1-TRNA-1_B23WHTKLT4_1_1																																	155.5bp	97.9%	96.5M																87.5%	53%	151bp	151bp	18%	341.7M
659_c95-T1-TRNA-1_B23WHTKLT4_1_2																																																			86.8%	54%	151bp	151bp	18%	341.7M
659_c95-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			75.7%	54%	131bp	147bp	18%	98.6M	75.7%	54%	131bp	147bp	18%	98.6M
659_c95-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			76.5%	54%	131bp	147bp	9%	98.6M	76.5%	54%	131bp	147bp	9%	98.6M
659_cAd-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	133.5bp	123.0bp	0.01%	1.18%	0.69%	0.00%	0.01%	3.63%	1.05%	0.00%	9999000000	58929541	196632712	0.01%	0.65%	68590103	0.92%	0.95%	0.06%	0.05%	63056717	31779922	4342002	1727595	106.49	39.00	0.55%	0.30%	0.98	0.000				143bp	275bp	65.5%	0.0%	97.5%	89.3%	95.7%	94.1M	41.7%	97.5%	23663.9Mb	196.6M	55.8%	98.3%	66.2%
659_cAd-T1-TRNA-1_B23WHTKLT4_1_1																																	133.5bp	98.0%	96.4M																90.6%	55%	151bp	151bp	18%	321.2M
659_cAd-T1-TRNA-1_B23WHTKLT4_1_2																																																			89.5%	55%	151bp	151bp	18%	321.2M
659_cAd-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			80.5%	55%	123bp	127bp	18%	98.3M	80.5%	55%	123bp	127bp	18%	98.3M
659_cAd-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			81.2%	56%	124bp	127bp	9%	98.3M	81.2%	56%	124bp	127bp	9%	98.3M
659_cIX-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	149.2bp	136.0bp	0.00%	0.93%	0.52%	0.00%	0.01%	3.12%	0.81%	0.00%	9999000000	79662480	197236088	0.00%	0.56%	86026606	0.94%	0.96%	0.05%	0.04%	80571200	40728532	4589445	1641124	155.08	54.00	0.59%	0.38%	0.98	0.000				179bp	412bp	56.6%	0.0%	97.6%	91.7%	96.7%	95.3M	38.9%	97.5%	25052.8Mb	197.2M	55.9%	98.6%	54.7%
659_cIX-T1-TRNA-1_B23WHTKLT4_1_1																																	149.2bp	98.2%	96.9M																89.3%	54%	151bp	151bp	18%	308.3M
659_cIX-T1-TRNA-1_B23WHTKLT4_1_2																																																			88.1%	55%	151bp	151bp	18%	308.3M
659_cIX-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			78.7%	55%	130bp	142bp	18%	98.6M	78.7%	55%	130bp	142bp	18%	98.6M
659_cIX-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			79.1%	56%	130bp	142bp	9%	98.6M	79.1%	56%	130bp	142bp	9%	98.6M
659_cRB-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	120.9bp	114.0bp	0.01%	1.07%	0.62%	0.00%	0.02%	3.50%	0.98%	0.00%	9999000000	57034238	197070276	0.01%	0.70%	59476560	0.91%	0.94%	0.07%	0.06%	54351119	27330787	4049552	1718946	85.88	36.00	0.54%	0.24%	0.98	0.000				134bp	257bp	70.2%	0.0%	97.7%	89.7%	95.9%	94.5M	41.0%	97.5%	22685.0Mb	197.1M	55.8%	98.5%	75.4%
659_cRB-T1-TRNA-1_B23WHTKLT4_1_1																																	120.9bp	98.2%	96.8M																89.3%	54%	151bp	151bp	18%	247.4M
659_cRB-T1-TRNA-1_B23WHTKLT4_1_2																																																			88.2%	55%	151bp	151bp	18%	247.4M
659_cRB-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			80.9%	55%	118bp	117bp	18%	98.5M	80.9%	55%	118bp	117bp	18%	98.5M
659_cRB-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			81.1%	55%	118bp	117bp	9%	98.5M	81.1%	55%	118bp	117bp	9%	98.5M
659_cRa-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	151.8bp	138.0bp	0.00%	0.89%	0.49%	0.00%	0.01%	3.18%	0.81%	0.00%	9999000000	89618419	197149710	0.01%	0.55%	89400749	0.94%	0.97%	0.05%	0.03%	84068708	42512496	4316542	1459445	168.41	71.00	0.64%	0.43%	0.97	0.000				242bp	575bp	54.9%	0.0%	98.1%	91.7%	96.5%	95.1M	37.3%	97.4%	25288.4Mb	197.1M	56.3%	98.6%	51.7%
659_cRa-T1-TRNA-1_B23WHTKLT4_1_1																																	151.8bp	98.4%	97.0M																91.6%	55%	151bp	151bp	27%	444.4M
659_cRa-T1-TRNA-1_B23WHTKLT4_1_2																																																			90.5%	56%	151bp	151bp	27%	444.4M
659_cRa-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			79.4%	56%	132bp	147bp	27%	98.6M	79.4%	56%	132bp	147bp	27%	98.6M
659_cRa-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			80.0%	56%	132bp	147bp	18%	98.6M	80.0%	56%	132bp	147bp	18%	98.6M
659_cTi-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	145.5bp	131.0bp	0.01%	0.94%	0.52%	0.00%	0.01%	2.94%	0.80%	0.00%	9999000000	87368115	196653706	0.01%	0.54%	91415369	0.94%	0.97%	0.05%	0.03%	85896459	43385081	4386755	1521842	160.40	74.00	0.66%	0.43%	0.98	0.000				179bp	444bp	53.8%	0.0%	97.9%	90.7%	96.0%	94.4M	35.4%	97.5%	24449.0Mb	196.7M	54.9%	98.3%	58.1%
659_cTi-T1-TRNA-1_B23WHTKLT4_1_1																																	145.5bp	98.2%	96.5M																90.4%	54%	151bp	151bp	18%	381.5M
659_cTi-T1-TRNA-1_B23WHTKLT4_1_2																																																			89.2%	54%	151bp	151bp	18%	381.5M
659_cTi-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			78.3%	54%	128bp	137bp	18%	98.3M	78.3%	54%	128bp	137bp	18%	98.3M
659_cTi-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			79.0%	55%	128bp	137bp	9%	98.3M	79.0%	55%	128bp	137bp	9%	98.3M
659_cVw-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	168.8bp	152.0bp	0.01%	1.20%	0.46%	0.00%	0.01%	3.92%	0.75%	0.00%	9999000000	108922117	197067362	0.01%	0.48%	103452493	0.94%	0.97%	0.05%	0.03%	97138246	49263501	5210818	1633087	205.26	83.00	0.64%	0.46%	0.97	0.000				217bp	514bp	47.8%	0.0%	97.5%	88.9%	95.5%	94.2M	33.9%	97.3%	25969.6Mb	197.1M	56.6%	98.5%	43.5%
659_cVw-T1-TRNA-1_B23WHTKLT4_1_1																																	168.8bp	98.0%	96.6M																89.9%	55%	151bp	151bp	18%	379.3M
659_cVw-T1-TRNA-1_B23WHTKLT4_1_2																																																			88.7%	56%	151bp	151bp	18%	379.3M
659_cVw-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			77.7%	56%	135bp	151bp	18%	98.5M	77.7%	56%	135bp	151bp	18%	98.5M
659_cVw-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			78.2%	56%	135bp	151bp	9%	98.5M	78.2%	56%	135bp	151bp	9%	98.5M
659_cWx-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	152.0bp	137.0bp	0.01%	1.19%	0.43%	0.00%	0.01%	3.75%	0.71%	0.00%	9999000000	39902103	195853974	0.01%	0.74%	50500296	0.90%	0.94%	0.08%	0.06%	45421961	22995026	3954428	1455507	84.33	26.00	0.48%	0.23%	0.97	0.000				181bp	348bp	74.6%	0.0%	96.7%	87.6%	95.3%	93.3M	52.3%	97.2%	24838.2Mb	195.9M	60.0%	97.9%	52.3%
659_cWx-T1-TRNA-1_B23WHTKLT4_1_1																																	152.0bp	97.5%	95.5M																92.4%	58%	151bp	151bp	18%	299.1M
659_cWx-T1-TRNA-1_B23WHTKLT4_1_2																																																			90.5%	59%	151bp	151bp	18%	299.1M
659_cWx-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			84.5%	59%	130bp	147bp	18%	97.9M	84.5%	59%	130bp	147bp	18%	97.9M
659_cWx-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			84.6%	60%	131bp	147bp	9%	97.9M	84.6%	60%	131bp	147bp	9%	97.9M
659_cfy-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	153.0bp	140.0bp	0.01%	1.01%	0.65%	0.00%	0.02%	3.08%	0.94%	0.00%	9999000000	112877849	197129426	0.00%	0.47%	104342755	0.95%	0.97%	0.04%	0.03%	98962554	50059772	4584410	1473313	196.71	71.00	0.62%	0.44%	0.97	0.000				202bp	499bp	47.3%	0.0%	98.0%	91.8%	96.6%	95.2M	32.1%	97.4%	25279.0Mb	197.1M	56.4%	98.6%	51.9%
659_cfy-T1-TRNA-1_B23WHTKLT4_1_1																																	153.0bp	98.4%	97.0M																90.0%	55%	151bp	151bp	18%	412.3M
659_cfy-T1-TRNA-1_B23WHTKLT4_1_2																																																			89.0%	56%	151bp	151bp	18%	412.3M
659_cfy-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			77.2%	56%	132bp	147bp	18%	98.6M	77.2%	56%	132bp	147bp	18%	98.6M
659_cfy-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			78.1%	56%	132bp	147bp	9%	98.6M	78.1%	56%	132bp	147bp	9%	98.6M
659_ciJ-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	163.6bp	149.0bp	0.00%	0.85%	0.40%	0.00%	0.01%	2.68%	0.61%	0.00%	9999000000	93849929	196995918	0.01%	0.52%	95215608	0.93%	0.96%	0.06%	0.04%	88807817	45092841	5272906	1685939	179.43	75.00	0.65%	0.44%	0.97	0.000				203bp	460bp	52.0%	0.0%	96.8%	90.5%	96.0%	94.6M	36.7%	97.4%	25783.9Mb	197.0M	57.2%	98.5%	46.3%
659_ciJ-T1-TRNA-1_B23WHTKLT4_1_1																																	163.6bp	97.6%	96.2M																88.2%	56%	151bp	151bp	18%	289.8M
659_ciJ-T1-TRNA-1_B23WHTKLT4_1_2																																																			87.0%	57%	151bp	151bp	18%	289.8M
659_ciJ-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			77.6%	56%	134bp	151bp	18%	98.5M	77.6%	56%	134bp	151bp	18%	98.5M
659_ciJ-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			78.2%	57%	134bp	151bp	9%	98.5M	78.2%	57%	134bp	151bp	9%	98.5M
659_ciZ-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	124.6bp	117.0bp	0.01%	1.81%	0.69%	0.00%	0.01%	5.17%	1.03%	0.00%	9999000000	53690680	197000810	0.00%	0.67%	65162528	0.92%	0.95%	0.06%	0.05%	60097065	30257622	4110793	1682546	96.32	37.00	0.54%	0.28%	0.98	0.000				128bp	233bp	67.2%	0.0%	97.9%	88.6%	95.4%	94.0M	40.1%	97.5%	22856.2Mb	197.0M	54.7%	98.5%	73.9%
659_ciZ-T1-TRNA-1_B23WHTKLT4_1_1																																	124.6bp	98.3%	96.8M																90.9%	53%	151bp	151bp	18%	318.6M
659_ciZ-T1-TRNA-1_B23WHTKLT4_1_2																																																			89.6%	54%	151bp	151bp	18%	318.6M
659_ciZ-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			80.7%	54%	119bp	122bp	18%	98.5M	80.7%	54%	119bp	122bp	18%	98.5M
659_ciZ-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			80.9%	54%	119bp	122bp	9%	98.5M	80.9%	54%	119bp	122bp	9%	98.5M
659_d01-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	144.1bp	131.0bp	0.00%	1.01%	0.36%	0.00%	0.01%	3.27%	0.57%	0.00%	9999000000	76951418	196267362	0.01%	0.63%	72613330	0.92%	0.94%	0.07%	0.06%	66457652	33587302	5095627	1956494	117.94	55.00	0.61%	0.37%	0.97	0.000				151bp	266bp	63.3%	0.0%	96.1%	89.3%	95.8%	94.0M	41.7%	97.3%	24254.6Mb	196.3M	55.9%	98.1%	58.4%
659_d01-T1-TRNA-1_B23WHTKLT4_1_1																																	144.1bp	97.5%	95.7M																88.2%	55%	151bp	151bp	18%	249.1M
659_d01-T1-TRNA-1_B23WHTKLT4_1_2																																																			86.8%	55%	151bp	151bp	18%	249.1M
659_d01-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			78.6%	55%	127bp	137bp	18%	98.1M	78.6%	55%	127bp	137bp	18%	98.1M
659_d01-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			79.0%	56%	127bp	137bp	9%	98.1M	79.0%	56%	127bp	137bp	9%	98.1M
659_dES-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	147.6bp	136.0bp	0.01%	1.31%	0.38%	0.00%	0.01%	4.14%	0.64%	0.00%	9999000000	87939102	197425944	0.01%	0.53%	92456409	0.93%	0.95%	0.06%	0.05%	85912499	43405661	5496135	2104993	161.49	72.00	0.63%	0.43%	0.98	0.000				166bp	365bp	53.5%	0.0%	97.4%	89.0%	95.7%	94.4M	36.8%	97.5%	25015.4Mb	197.4M	53.7%	98.7%	56.8%
659_dES-T1-TRNA-1_B23WHTKLT4_1_1																																	147.6bp	98.0%	96.8M																89.0%	52%	151bp	151bp	18%	331.1M
659_dES-T1-TRNA-1_B23WHTKLT4_1_2																																																			88.2%	53%	151bp	151bp	18%	331.1M
659_dES-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			77.3%	53%	130bp	142bp	18%	98.7M	77.3%	53%	130bp	142bp	18%	98.7M
659_dES-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			78.1%	53%	130bp	142bp	9%	98.7M	78.1%	53%	130bp	142bp	9%	98.7M
659_dc8-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	152.9bp	139.0bp	0.01%	1.63%	0.47%	0.00%	0.02%	4.91%	0.74%	0.00%	9999000000	64740972	196281428	0.01%	0.62%	73877446	0.92%	0.95%	0.06%	0.05%	68213006	34556159	4674231	1643602	131.21	58.00	0.61%	0.38%	0.98	0.000				189bp	427bp	62.7%	0.0%	96.9%	89.5%	95.7%	94.0M	44.0%	97.4%	25098.2Mb	196.3M	56.0%	98.1%	51.4%
659_dc8-T1-TRNA-1_B23WHTKLT4_1_1																																	152.9bp	97.7%	95.9M																90.7%	55%	151bp	151bp	18%	312.2M
659_dc8-T1-TRNA-1_B23WHTKLT4_1_2																																																			89.2%	55%	151bp	151bp	18%	312.2M
659_dc8-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			80.6%	55%	131bp	147bp	18%	98.1M	80.6%	55%	131bp	147bp	18%	98.1M
659_dc8-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			81.1%	56%	131bp	147bp	9%	98.1M	81.1%	56%	131bp	147bp	9%	98.1M
659_dcz-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	117.8bp	113.0bp	0.01%	1.22%	0.27%	0.00%	0.01%	3.74%	0.47%	0.00%	9999000000	15869757	95842054	0.01%	0.88%	11541198	0.72%	0.78%	0.21%	0.22%	8355873	4188498	2435400	1157885	11.41	4.00	0.09%	0.01%	0.98	0.000				115bp	148bp	88.7%	0.0%	95.9%	85.1%	94.3%	45.2M	53.1%	97.4%	10686.3Mb	95.8M	55.3%	97.5%	80.9%
659_dcz-T1-TRNA-1_B23WHTKLT4_1_1																																	117.8bp	96.6%	46.3M																87.8%	54%	151bp	151bp	18%	49.2M
659_dcz-T1-TRNA-1_B23WHTKLT4_1_2																																																			86.5%	55%	151bp	151bp	36%	49.2M
659_dcz-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			87.7%	55%	114bp	112bp	9%	47.9M	87.7%	55%	114bp	112bp	9%	47.9M
659_dcz-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			87.5%	55%	115bp	117bp	9%	47.9M	87.5%	55%	115bp	117bp	9%	47.9M
659_djb-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	140.4bp	131.0bp	0.01%	1.72%	0.56%	0.00%	0.02%	5.20%	0.89%	0.00%	9999000000	74543809	197340982	0.00%	0.59%	80713650	0.93%	0.95%	0.06%	0.05%	74870343	37765099	4857266	1922156	133.65	51.00	0.58%	0.36%	0.98	0.000				164bp	369bp	59.4%	0.0%	97.6%	90.1%	96.0%	94.8M	40.6%	97.6%	24664.9Mb	197.3M	54.3%	98.7%	61.6%
659_djb-T1-TRNA-1_B23WHTKLT4_1_1																																	140.4bp	98.1%	96.8M																89.0%	53%	151bp	151bp	18%	301.9M
659_djb-T1-TRNA-1_B23WHTKLT4_1_2																																																			88.1%	54%	151bp	151bp	18%	301.9M
659_djb-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			78.3%	54%	128bp	137bp	18%	98.7M	78.3%	54%	128bp	137bp	18%	98.7M
659_djb-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			79.0%	54%	128bp	137bp	9%	98.7M	79.0%	54%	128bp	137bp	9%	98.7M
659_dm4-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	120.5bp	114.0bp	0.01%	1.25%	0.28%	0.00%	0.02%	3.80%	0.48%	0.00%	9999000000	28955328	196079036	0.01%	0.88%	22645474	0.76%	0.82%	0.18%	0.18%	17296068	8676521	4088831	1906998	25.31	10.00	0.24%	0.04%	0.98	0.000				117bp	155bp	89.0%	0.0%	96.1%	85.5%	94.6%	92.7M	54.2%	97.4%	22167.7Mb	196.1M	55.8%	98.0%	77.8%
659_dm4-T1-TRNA-1_B23WHTKLT4_1_1																																	120.5bp	97.2%	95.2M																89.6%	55%	151bp	151bp	18%	104.2M
659_dm4-T1-TRNA-1_B23WHTKLT4_1_2																																																			88.2%	55%	151bp	151bp	27%	104.2M
659_dm4-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			89.3%	55%	116bp	117bp	9%	98.0M	89.3%	55%	116bp	117bp	9%	98.0M
659_dm4-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			89.0%	55%	116bp	117bp	9%	98.0M	89.0%	55%	116bp	117bp	9%	98.0M
659_dts-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	135.7bp	124.0bp	0.00%	0.90%	0.46%	0.00%	0.01%	2.83%	0.71%	0.00%	9999000000	67536748	196518296	0.01%	0.61%	75702594	0.93%	0.95%	0.06%	0.05%	70108519	35350494	4454891	1708302	121.33	56.00	0.61%	0.36%	0.97	0.000				144bp	286bp	61.8%	0.0%	97.5%	89.0%	95.6%	93.9M	38.8%	97.4%	23687.1Mb	196.5M	55.9%	98.3%	64.9%
659_dts-T1-TRNA-1_B23WHTKLT4_1_1																																	135.7bp	98.1%	96.4M																87.1%	54%	151bp	151bp	18%	209.5M
659_dts-T1-TRNA-1_B23WHTKLT4_1_2																																																			85.9%	55%	151bp	151bp	18%	209.5M
659_dts-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			79.4%	55%	124bp	127bp	18%	98.3M	79.4%	55%	124bp	127bp	18%	98.3M
659_dts-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			79.9%	56%	124bp	132bp	9%	98.3M	79.9%	56%	124bp	132bp	9%	98.3M
659_ecd-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	167.6bp	151.0bp	0.01%	0.78%	0.35%	0.00%	0.01%	2.52%	0.54%	0.00%	9999000000	154438178	197427790	0.00%	0.40%	118715461	0.94%	0.97%	0.05%	0.03%	112178525	56916677	5713812	1759593	237.13	101.00	0.67%	0.50%	0.97	0.000				232bp	619bp	40.0%	0.0%	97.5%	91.0%	96.4%	95.1M	28.3%	97.4%	26051.9Mb	197.4M	54.9%	98.7%	43.7%
659_ecd-T1-TRNA-1_B23WHTKLT4_1_1																																	167.6bp	98.1%	96.8M																87.1%	54%	151bp	151bp	18%	334.2M
659_ecd-T1-TRNA-1_B23WHTKLT4_1_2																																																			86.4%	54%	151bp	151bp	18%	334.2M
659_ecd-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			74.9%	54%	135bp	151bp	18%	98.7M	74.9%	54%	135bp	151bp	18%	98.7M
659_ecd-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			75.8%	55%	135bp	151bp	9%	98.7M	75.8%	55%	135bp	151bp	9%	98.7M
659_epP-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	152.0bp	139.0bp	0.00%	0.76%	0.36%	0.00%	0.01%	2.46%	0.58%	0.00%	9999000000	61636040	196912472	0.01%	0.63%	73189574	0.92%	0.96%	0.06%	0.04%	67666832	34264115	4435101	1578280	128.89	53.00	0.59%	0.37%	0.97	0.000				175bp	343bp	63.2%	0.0%	96.8%	87.0%	94.9%	93.5M	44.6%	97.4%	25191.6Mb	196.9M	57.5%	98.5%	52.7%
659_epP-T1-TRNA-1_B23WHTKLT4_1_1																																	152.0bp	97.8%	96.3M																90.8%	56%	151bp	151bp	18%	326.1M
659_epP-T1-TRNA-1_B23WHTKLT4_1_2																																																			89.4%	57%	151bp	151bp	18%	326.1M
659_epP-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			80.2%	57%	131bp	147bp	18%	98.5M	80.2%	57%	131bp	147bp	18%	98.5M
659_epP-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			80.4%	57%	131bp	147bp	9%	98.5M	80.4%	57%	131bp	147bp	9%	98.5M
659_ezg-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	150.9bp	138.0bp	0.01%	1.55%	0.61%	0.00%	0.01%	4.73%	0.93%	0.00%	9999000000	91191598	197246722	0.01%	0.53%	92381001	0.94%	0.96%	0.05%	0.04%	86571763	43784669	4786049	1681641	165.84	68.00	0.62%	0.42%	0.98	0.000				184bp	416bp	53.4%	0.0%	97.5%	89.4%	95.9%	94.6M	36.8%	97.5%	25189.6Mb	197.2M	55.9%	98.6%	54.6%
659_ezg-T1-TRNA-1_B23WHTKLT4_1_1																																	150.9bp	97.9%	96.5M																90.5%	55%	151bp	151bp	18%	403.5M
659_ezg-T1-TRNA-1_B23WHTKLT4_1_2																																																			89.4%	55%	151bp	151bp	18%	403.5M
659_ezg-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			77.6%	55%	131bp	142bp	18%	98.6M	77.6%	55%	131bp	142bp	18%	98.6M
659_ezg-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			78.6%	56%	131bp	142bp	9%	98.6M	78.6%	56%	131bp	142bp	9%	98.6M
659_gK-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	159.4bp	143.0bp	0.01%	1.44%	0.48%	0.00%	0.02%	4.51%	0.76%	0.00%	9999000000	73487980	196538544	0.00%	0.61%	76305392	0.93%	0.96%	0.06%	0.04%	70764655	35884224	4607512	1546742	140.17	52.00	0.58%	0.38%	0.97	0.000				194bp	451bp	61.5%	0.0%	97.2%	88.4%	95.3%	93.6M	43.2%	97.3%	25344.7Mb	196.5M	55.2%	98.3%	48.6%
659_gK-T1-TRNA-1_B23WHTKLT4_1_1																																	159.4bp	98.0%	96.3M																87.0%	54%	151bp	151bp	18%	188.5M
659_gK-T1-TRNA-1_B23WHTKLT4_1_2																																																			85.8%	55%	151bp	151bp	18%	188.5M
659_gK-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			80.5%	54%	132bp	151bp	9%	98.3M	80.5%	54%	132bp	151bp	9%	98.3M
659_gK-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			80.9%	55%	133bp	151bp	9%	98.3M	80.9%	55%	133bp	151bp	9%	98.3M
659_rd-T1-TRNA-1_B23WHTKLT4_1	No	0.00%	167.3bp	152.0bp	0.00%	1.15%	0.29%	0.00%	0.00%	3.94%	0.49%	0.00%	9999000000	132309497	197290518	0.00%	0.44%	110438371	0.94%	0.97%	0.05%	0.03%	103972639	52755434	5566524	1744792	220.05	86.00	0.65%	0.47%	0.97	0.000				231bp	618bp	44.2%	0.0%	97.3%	92.3%	96.7%	95.4M	31.7%	97.4%	26135.1Mb	197.3M	54.6%	98.6%	43.4%
659_rd-T1-TRNA-1_B23WHTKLT4_1_1																																	167.3bp	98.0%	96.7M																87.9%	54%	151bp	151bp	18%	342.6M
659_rd-T1-TRNA-1_B23WHTKLT4_1_2																																																			87.3%	54%	151bp	151bp	18%	342.6M
659_rd-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			76.2%	54%	136bp	151bp	18%	98.6M	76.2%	54%	136bp	151bp	18%	98.6M
659_rd-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			77.1%	54%	136bp	151bp	9%	98.6M	77.1%	54%	136bp	151bp	9%	98.6M
FFPE_HD789_01_RNA_13_B23WHTKLT4_1	Yes	65.74%	179.1bp	163.0bp	0.01%	1.65%	0.69%	0.00%	0.01%	4.80%	0.99%	0.00%	9999000000	376478085	197516332	0.00%	0.27%	144795271	0.95%	0.98%	0.04%	0.02%	137822516	69997047	6077223	1628909	310.00	114.00	0.65%	0.52%	0.98	0.000				316bp	911bp	26.8%	0.0%	97.8%	91.3%	96.5%	95.3M	19.3%	97.5%	26719.2Mb	197.5M	54.8%	98.8%	36.7%
FFPE_HD789_01_RNA_13_B23WHTKLT4_1_1																																	179.1bp	98.1%	96.9M																87.9%	54%	151bp	151bp	18%	519.2M
FFPE_HD789_01_RNA_13_B23WHTKLT4_1_2																																																			87.3%	54%	151bp	151bp	18%	519.2M
FFPE_HD789_01_RNA_13_B23WHTKLT4_1_trimmed_1																																																			74.5%	54%	139bp	151bp	18%	98.8M	74.5%	54%	139bp	151bp	18%	98.8M
FFPE_HD789_01_RNA_13_B23WHTKLT4_1_trimmed_2																																																			75.4%	55%	139bp	151bp	9%	98.8M	75.4%	55%	139bp	151bp	9%	98.8M
FFPE_V4_0002_RNA_0001_B23WHTKLT4_1	No	0.00%	165.7bp	151.0bp	0.01%	1.68%	1.04%	0.00%	0.01%	4.66%	1.44%	0.00%	9999000000	248164097	197305728	0.01%	0.33%	132570835	0.94%	0.97%	0.05%	0.03%	124852034	63393006	6496057	1998091	262.91	59.00	0.55%	0.45%	0.97	0.000				219bp	548bp	33.0%	0.0%	96.7%	89.5%	95.8%	94.5M	22.9%	97.4%	25952.4Mb	197.3M	55.1%	98.7%	44.6%
FFPE_V4_0002_RNA_0001_B23WHTKLT4_1_1																																	165.7bp	96.9%	95.6M																86.2%	54%	151bp	151bp	18%	318.2M
FFPE_V4_0002_RNA_0001_B23WHTKLT4_1_2																																																			85.8%	55%	151bp	151bp	18%	318.2M
FFPE_V4_0002_RNA_0001_B23WHTKLT4_1_trimmed_1																																																			76.0%	54%	135bp	151bp	18%	98.7M	76.0%	54%	135bp	151bp	18%	98.7M
FFPE_V4_0002_RNA_0001_B23WHTKLT4_1_trimmed_2																																																			76.9%	55%	135bp	151bp	9%	98.7M	76.9%	55%	135bp	151bp	9%	98.7M
NTC_0001_0001_B23WHTKLT4_1	Skipped	N/A%	90.2bp	31.0bp	0.00%	0.00%	0.04%	0.00%	0.00%	0.00%	0.08%	0.00%	9999000000	48139	53950	0.57%	0.26%	40048	0.01%	0.03%	0.22%	0.97%	257	135	8828	4270	0.00	0.00	0.00%	0.00%	0.89	0.000				48bp	62bp	60.5%	0.1%	21.7%	3.0%	10.0%	0.0M	67.3%	89.1%	5.1Mb	0.1M	66.5%	3.2%	50.6%
NTC_0001_0001_B23WHTKLT4_1_1																																	90.2bp	10.7%	0.0M																98.1%	73%	151bp	151bp	55%	0.8M
NTC_0001_0001_B23WHTKLT4_1_2																																																			97.0%	98%	151bp	151bp	55%	0.8M
NTC_0001_0001_B23WHTKLT4_1_trimmed_1																																																			58.6%	62%	106bp	112bp	55%	0.0M	58.6%	62%	106bp	112bp	55%	0.0M
NTC_0001_0001_B23WHTKLT4_1_trimmed_2																																																			61.7%	69%	107bp	112bp	55%	0.0M	61.7%	69%	107bp	112bp	55%	0.0M
tih_rna_sample_00087_B23WHTKLT4_1	No	0.00%	156.8bp	144.0bp	0.01%	1.54%	0.58%	0.00%	0.01%	4.80%	0.85%	0.00%	9999000000	217072750	197564558	0.00%	0.34%	130181070	0.94%	0.97%	0.05%	0.03%	122813604	62166524	6407578	2197723	248.63	100.00	0.64%	0.50%	0.98	0.000				196bp	473bp	34.3%	0.0%	96.9%	89.5%	95.8%	94.6M	23.2%	97.6%	25737.0Mb	197.6M	54.2%	98.8%	49.1%
tih_rna_sample_00087_B23WHTKLT4_1_1																																	156.8bp	98.0%	96.9M																88.2%	53%	151bp	151bp	18%	497.8M
tih_rna_sample_00087_B23WHTKLT4_1_2																																																			87.4%	54%	151bp	151bp	18%	497.8M
tih_rna_sample_00087_B23WHTKLT4_1_trimmed_1																																																			73.3%	53%	133bp	151bp	18%	98.8M	73.3%	53%	133bp	151bp	18%	98.8M
tih_rna_sample_00087_B23WHTKLT4_1_trimmed_2																																																			74.3%	54%	134bp	151bp	9%	98.8M	74.3%	54%	134bp	151bp	9%	98.8M
tih_rna_sample_00087_B23WHTKLT4_2	No	0.00%	150.4bp	137.0bp	0.01%	1.59%	0.60%	0.00%	0.01%	4.90%	0.87%	0.00%	9999000000	346942341	197399094	0.01%	0.28%	141339255	0.94%	0.97%	0.05%	0.03%	133512976	67502715	6834801	2399430	263.12	107.00	0.64%	0.51%	0.97	0.000				177bp	409bp	28.5%	0.0%	96.9%	89.2%	95.7%	94.4M	17.5%	97.3%	25036.3Mb	197.4M	54.0%	98.7%	53.5%
tih_rna_sample_00087_B23WHTKLT4_2_1																																	150.4bp	98.0%	96.7M																86.1%	53%	151bp	151bp	18%	441.5M
tih_rna_sample_00087_B23WHTKLT4_2_2																																																			85.7%	54%	151bp	151bp	18%	441.5M
tih_rna_sample_00087_B23WHTKLT4_2_trimmed_1																																																			73.0%	53%	130bp	147bp	18%	98.7M	73.0%	53%	130bp	147bp	18%	98.7M
tih_rna_sample_00087_B23WHTKLT4_2_trimmed_2																																																			73.8%	54%	130bp	147bp	9%	98.7M	73.8%	54%	130bp	147bp	9%	98.7M
tih_rna_sample_00089_B23WHTKLT4_1	No	0.00%	154.4bp	140.0bp	0.01%	1.38%	0.55%	0.00%	0.02%	4.25%	0.84%	0.00%	9999000000	125107165	197396692	0.00%	0.45%	109438580	0.95%	0.97%	0.05%	0.03%	103449879	52353580	5155425	1705097	204.37	85.00	0.64%	0.47%	0.98	0.000				193bp	454bp	44.7%	0.0%	97.2%	89.3%	96.0%	94.7M	29.0%	97.4%	25293.5Mb	197.4M	56.1%	98.7%	52.2%
tih_rna_sample_00089_B23WHTKLT4_1_1																																	154.4bp	98.2%	97.0M																83.3%	55%	151bp	151bp	18%	187.3M
tih_rna_sample_00089_B23WHTKLT4_1_2																																																			82.8%	55%	151bp	151bp	18%	187.3M
tih_rna_sample_00089_B23WHTKLT4_1_trimmed_1																																																			76.3%	55%	131bp	147bp	9%	98.7M	76.3%	55%	131bp	147bp	9%	98.7M
tih_rna_sample_00089_B23WHTKLT4_1_trimmed_2																																																			77.1%	56%	132bp	147bp	9%	98.7M	77.1%	56%	132bp	147bp	9%	98.7M
tih_rna_sample_00089_B23WHTKLT4_2	No	0.00%	152.6bp	140.0bp	0.01%	1.41%	0.56%	0.00%	0.02%	4.31%	0.85%	0.00%	9999000000	217457565	197309616	0.00%	0.34%	129967563	0.95%	0.97%	0.04%	0.03%	123294518	62386178	5789396	1883484	245.41	103.00	0.66%	0.51%	0.97	0.000				194bp	458bp	34.3%	0.0%	97.2%	89.2%	95.9%	94.6M	22.9%	97.4%	25275.9Mb	197.3M	56.0%	98.7%	51.8%
tih_rna_sample_00089_B23WHTKLT4_2_1																																	152.6bp	98.2%	96.8M																86.5%	55%	151bp	151bp	18%	364.2M
tih_rna_sample_00089_B23WHTKLT4_2_2																																																			85.9%	55%	151bp	151bp	18%	364.2M
tih_rna_sample_00089_B23WHTKLT4_2_trimmed_1																																																			74.2%	55%	131bp	147bp	18%	98.7M	74.2%	55%	131bp	147bp	18%	98.7M
tih_rna_sample_00089_B23WHTKLT4_2_trimmed_2																																																			75.2%	56%	132bp	147bp	9%	98.7M	75.2%	56%	132bp	147bp	9%	98.7M
tih_rna_sample_00090_B23WHTKLT4_1	No	0.00%	125.3bp	118.0bp	0.00%	1.23%	0.55%	0.00%	0.01%	3.55%	0.85%	0.00%	9999000000	54885703	196549450	0.01%	0.70%	59506552	0.91%	0.94%	0.07%	0.06%	53999490	27188480	4205310	1735125	87.95	20.00	0.44%	0.22%	0.97	0.000				131bp	210bp	70.2%	0.0%	97.2%	83.9%	94.1%	92.5M	41.1%	97.2%	22844.3Mb	196.5M	60.3%	98.3%	71.9%
tih_rna_sample_00090_B23WHTKLT4_1_1																																	125.3bp	97.6%	95.9M																89.0%	58%	151bp	151bp	18%	212.6M
tih_rna_sample_00090_B23WHTKLT4_1_2																																																			87.7%	59%	151bp	151bp	18%	212.6M
tih_rna_sample_00090_B23WHTKLT4_1_trimmed_1																																																			82.1%	60%	119bp	122bp	18%	98.3M	82.1%	60%	119bp	122bp	18%	98.3M
tih_rna_sample_00090_B23WHTKLT4_1_trimmed_2																																																			82.3%	60%	120bp	122bp	9%	98.3M	82.3%	60%	120bp	122bp	9%	98.3M
tih_rna_sample_00090_B23WHTKLT4_2	No	0.00%	129.6bp	121.0bp	0.01%	1.25%	0.56%	0.00%	0.01%	3.60%	0.85%	0.00%	9999000000	80165315	196281870	0.01%	0.58%	82791797	0.93%	0.95%	0.06%	0.05%	76804232	38658328	4679962	1844917	127.45	31.00	0.51%	0.30%	0.97	0.000				136bp	228bp	58.2%	0.0%	97.2%	84.5%	94.2%	92.4M	35.4%	97.3%	23289.8Mb	196.3M	59.7%	98.1%	69.3%
tih_rna_sample_00090_B23WHTKLT4_2_1																																	129.6bp	97.8%	95.9M																89.7%	58%	151bp	151bp	18%	334.5M
tih_rna_sample_00090_B23WHTKLT4_2_2																																																			88.2%	58%	151bp	151bp	18%	334.5M
tih_rna_sample_00090_B23WHTKLT4_2_trimmed_1																																																			78.8%	59%	122bp	127bp	18%	98.1M	78.8%	59%	122bp	127bp	18%	98.1M
tih_rna_sample_00090_B23WHTKLT4_2_trimmed_2																																																			79.4%	59%	122bp	127bp	9%	98.1M	79.4%	59%	122bp	127bp	9%	98.1M
tih_rna_sample_00096_B23WHTKLT4_1	No	0.00%	154.7bp	141.0bp	0.01%	0.69%	0.33%	0.00%	0.02%	2.18%	0.52%	0.00%	9999000000	128613907	197275284	0.00%	0.43%	111526395	0.94%	0.97%	0.05%	0.03%	105045267	53172190	5542973	1878636	206.28	94.00	0.66%	0.49%	0.98	0.000				179bp	393bp	43.7%	0.0%	97.0%	90.7%	96.3%	95.0M	30.0%	97.5%	25384.5Mb	197.3M	55.0%	98.6%	52.0%
tih_rna_sample_00096_B23WHTKLT4_1_1																																	154.7bp	98.0%	96.7M																87.0%	54%	151bp	151bp	18%	331.9M
tih_rna_sample_00096_B23WHTKLT4_1_2																																																			86.3%	54%	151bp	151bp	18%	331.9M
tih_rna_sample_00096_B23WHTKLT4_1_trimmed_1																																																			74.3%	54%	132bp	147bp	18%	98.6M	74.3%	54%	132bp	147bp	18%	98.6M
tih_rna_sample_00096_B23WHTKLT4_1_trimmed_2																																																			75.2%	55%	132bp	147bp	9%	98.6M	75.2%	55%	132bp	147bp	9%	98.6M
tih_rna_sample_00096_B23WHTKLT4_2	No	0.00%	150.4bp	138.0bp	0.01%	0.71%	0.34%	0.00%	0.02%	2.24%	0.52%	0.00%	9999000000	198575439	197248680	0.00%	0.35%	128600504	0.95%	0.97%	0.05%	0.03%	121700313	61552887	5941642	2007465	238.10	110.00	0.68%	0.52%	0.98	0.000				173bp	379bp	35.0%	0.0%	97.0%	90.7%	96.3%	95.0M	22.9%	97.4%	25133.4Mb	197.2M	54.7%	98.6%	53.5%
tih_rna_sample_00096_B23WHTKLT4_2_1																																	150.4bp	98.0%	96.7M																86.9%	53%	151bp	151bp	18%	400.2M
tih_rna_sample_00096_B23WHTKLT4_2_2																																																			86.0%	54%	151bp	151bp	18%	400.2M
tih_rna_sample_00096_B23WHTKLT4_2_trimmed_1																																																			73.2%	54%	131bp	147bp	18%	98.6M	73.2%	54%	131bp	147bp	18%	98.6M
tih_rna_sample_00096_B23WHTKLT4_2_trimmed_2																																																			74.0%	54%	131bp	147bp	9%	98.6M	74.0%	54%	131bp	147bp	9%	98.6M
tih_rna_sample_00097_B23WHTKLT4_1	No	0.00%	133.3bp	124.0bp	0.01%	2.33%	0.75%	0.00%	0.01%	6.28%	1.09%	0.00%	9999000000	86202053	197388504	0.00%	0.54%	91134335	0.94%	0.96%	0.05%	0.04%	85879769	43314879	4404082	1643386	149.95	55.00	0.59%	0.38%	0.98	0.000				156bp	379bp	54.1%	0.0%	97.8%	89.0%	95.7%	94.4M	33.1%	97.6%	23816.2Mb	197.4M	53.6%	98.7%	66.9%
tih_rna_sample_00097_B23WHTKLT4_1_1																																	133.3bp	98.3%	97.0M																90.6%	53%	151bp	151bp	18%	410.0M
tih_rna_sample_00097_B23WHTKLT4_1_2																																																			89.6%	53%	151bp	151bp	18%	410.0M
tih_rna_sample_00097_B23WHTKLT4_1_trimmed_1																																																			78.1%	53%	124bp	127bp	18%	98.7M	78.1%	53%	124bp	127bp	18%	98.7M
tih_rna_sample_00097_B23WHTKLT4_1_trimmed_2																																																			78.7%	53%	124bp	127bp	9%	98.7M	78.7%	53%	124bp	127bp	9%	98.7M
tih_rna_sample_00097_B23WHTKLT4_2	No	0.00%	128.9bp	119.0bp	0.01%	2.44%	0.77%	0.00%	0.02%	6.53%	1.12%	0.00%	9999000000	119534021	196878218	0.00%	0.47%	104807833	0.95%	0.97%	0.05%	0.03%	99166196	49964357	4761262	1762791	170.36	64.00	0.61%	0.41%	0.98	0.000				146bp	344bp	47.0%	0.0%	97.8%	88.6%	95.5%	94.0M	27.8%	97.5%	23264.9Mb	196.9M	53.3%	98.4%	69.3%
tih_rna_sample_00097_B23WHTKLT4_2_1																																	128.9bp	98.4%	96.9M																88.4%	52%	151bp	151bp	18%	339.3M
tih_rna_sample_00097_B23WHTKLT4_2_2																																																			86.9%	53%	151bp	151bp	18%	339.3M
tih_rna_sample_00097_B23WHTKLT4_2_trimmed_1																																																			76.9%	53%	121bp	122bp	18%	98.4M	76.9%	53%	121bp	122bp	18%	98.4M
tih_rna_sample_00097_B23WHTKLT4_2_trimmed_2																																																			77.1%	53%	121bp	127bp	9%	98.4M	77.1%	53%	121bp	127bp	9%	98.4M
tih_rna_sample_00116_B23WHTKLT4_1	No	0.00%	129.4bp	122.0bp	0.01%	1.31%	0.69%	0.00%	0.01%	3.71%	0.98%	0.00%	9999000000	66965095	197185362	0.01%	0.65%	68743513	0.92%	0.95%	0.06%	0.05%	63566035	32024262	4053539	1616872	105.59	39.00	0.55%	0.29%	0.97	0.000				137bp	261bp	65.5%	0.0%	97.7%	89.7%	95.8%	94.4M	41.3%	97.3%	23468.8Mb	197.2M	56.4%	98.6%	70.3%
tih_rna_sample_00116_B23WHTKLT4_1_1																																	129.4bp	97.8%	96.4M																90.8%	55%	151bp	151bp	18%	318.8M
tih_rna_sample_00116_B23WHTKLT4_1_2																																																			89.5%	56%	151bp	151bp	18%	318.8M
tih_rna_sample_00116_B23WHTKLT4_1_trimmed_1																																																			80.6%	56%	122bp	127bp	18%	98.6M	80.6%	56%	122bp	127bp	18%	98.6M
tih_rna_sample_00116_B23WHTKLT4_1_trimmed_2																																																			80.9%	56%	122bp	127bp	9%	98.6M	80.9%	56%	122bp	127bp	9%	98.6M
tih_rna_sample_00116_B23WHTKLT4_2	No	0.00%	128.0bp	119.0bp	0.01%	1.36%	0.71%	0.00%	0.01%	3.83%	1.00%	0.00%	9999000000	92796301	196663934	0.01%	0.52%	93568422	0.94%	0.96%	0.05%	0.04%	87923897	44253316	4525098	1741481	145.90	58.00	0.61%	0.38%	0.98	0.000				133bp	249bp	52.7%	0.0%	97.7%	89.6%	95.7%	94.1M	31.5%	97.5%	23089.0Mb	196.7M	56.0%	98.3%	71.7%
tih_rna_sample_00116_B23WHTKLT4_2_1																																	128.0bp	97.9%	96.3M																87.5%	54%	151bp	151bp	18%	284.2M
tih_rna_sample_00116_B23WHTKLT4_2_2																																																			86.3%	55%	151bp	151bp	18%	284.2M
tih_rna_sample_00116_B23WHTKLT4_2_trimmed_1																																																			76.9%	55%	120bp	122bp	18%	98.3M	76.9%	55%	120bp	122bp	18%	98.3M
tih_rna_sample_00116_B23WHTKLT4_2_trimmed_2																																																			77.5%	56%	121bp	122bp	9%	98.3M	77.5%	56%	121bp	122bp	9%	98.3M
tih_rna_sample_00121_B23WHTKLT4_1	No	0.00%	144.9bp	133.0bp	0.01%	0.89%	0.36%	0.00%	0.01%	2.88%	0.59%	0.00%	9999000000	106056193	197250148	0.00%	0.49%	100123570	0.94%	0.96%	0.05%	0.04%	94040577	47529483	5119162	1834699	177.66	85.00	0.66%	0.47%	0.98	0.000				166bp	344bp	49.5%	0.0%	96.9%	90.5%	96.1%	94.8M	32.0%	97.5%	24708.7Mb	197.3M	55.7%	98.6%	56.8%
tih_rna_sample_00121_B23WHTKLT4_1_1																																	144.9bp	98.0%	96.7M																87.5%	54%	151bp	151bp	18%	299.9M
tih_rna_sample_00121_B23WHTKLT4_1_2																																																			86.6%	55%	151bp	151bp	18%	299.9M
tih_rna_sample_00121_B23WHTKLT4_1_trimmed_1																																																			76.0%	55%	128bp	142bp	18%	98.6M	76.0%	55%	128bp	142bp	18%	98.6M
tih_rna_sample_00121_B23WHTKLT4_1_trimmed_2																																																			76.5%	55%	129bp	142bp	9%	98.6M	76.5%	55%	129bp	142bp	9%	98.6M
tih_rna_sample_00121_B23WHTKLT4_2	No	0.00%	149.8bp	137.0bp	0.01%	0.89%	0.37%	0.00%	0.01%	2.90%	0.60%	0.00%	9999000000	188140104	197459876	0.01%	0.37%	124521770	0.95%	0.97%	0.05%	0.03%	117844458	59566542	5685066	1958989	229.57	112.00	0.69%	0.52%	0.98	0.000				174bp	368bp	37.1%	0.0%	96.9%	90.6%	96.2%	94.9M	24.6%	97.5%	25196.6Mb	197.5M	55.5%	98.7%	54.2%
tih_rna_sample_00121_B23WHTKLT4_2_1																																	149.8bp	98.0%	96.8M																84.4%	54%	151bp	151bp	18%	303.7M
tih_rna_sample_00121_B23WHTKLT4_2_2																																																			84.1%	55%	151bp	151bp	18%	303.7M
tih_rna_sample_00121_B23WHTKLT4_2_trimmed_1																																																			72.8%	55%	131bp	142bp	18%	98.7M	72.8%	55%	131bp	142bp	18%	98.7M
tih_rna_sample_00121_B23WHTKLT4_2_trimmed_2																																																			73.9%	55%	131bp	142bp	9%	98.7M	73.9%	55%	131bp	142bp	9%	98.7M
tih_rna_sample_00124_B23WHTKLT4_1	No	0.00%	143.5bp	130.0bp	0.01%	0.98%	0.42%	0.00%	0.01%	3.18%	0.68%	0.00%	9999000000	99551526	197232380	0.01%	0.51%	97207233	0.94%	0.96%	0.05%	0.04%	91166032	46083803	4927839	1748828	171.69	82.00	0.66%	0.46%	0.98	0.000				174bp	385bp	51.0%	0.0%	97.0%	90.9%	96.2%	94.8M	33.8%	97.5%	24519.8Mb	197.2M	54.9%	98.6%	57.8%
tih_rna_sample_00124_B23WHTKLT4_1_1																																	143.5bp	97.9%	96.6M																85.9%	54%	151bp	151bp	18%	232.8M
tih_rna_sample_00124_B23WHTKLT4_1_2																																																			85.0%	54%	151bp	151bp	18%	232.8M
tih_rna_sample_00124_B23WHTKLT4_1_trimmed_1																																																			76.8%	54%	127bp	137bp	18%	98.6M	76.8%	54%	127bp	137bp	18%	98.6M
tih_rna_sample_00124_B23WHTKLT4_1_trimmed_2																																																			77.3%	55%	128bp	137bp	9%	98.6M	77.3%	55%	128bp	137bp	9%	98.6M
tih_rna_sample_00124_B23WHTKLT4_2	No	0.00%	150.1bp	137.0bp	0.01%	0.98%	0.41%	0.00%	0.01%	3.22%	0.67%	0.00%	9999000000	159524039	197529498	0.01%	0.41%	117122392	0.94%	0.97%	0.05%	0.03%	110591864	55945987	5378661	1816311	216.41	107.00	0.69%	0.51%	0.98	0.000				190bp	448bp	40.9%	0.0%	97.0%	91.3%	96.2%	95.0M	27.5%	97.6%	25292.7Mb	197.5M	54.3%	98.8%	53.4%
tih_rna_sample_00124_B23WHTKLT4_2_1																																	150.1bp	97.9%	96.7M																83.8%	53%	151bp	151bp	18%	227.9M
tih_rna_sample_00124_B23WHTKLT4_2_2																																																			82.9%	54%	151bp	151bp	18%	227.9M
tih_rna_sample_00124_B23WHTKLT4_2_trimmed_1																																																			75.3%	54%	131bp	147bp	18%	98.8M	75.3%	54%	131bp	147bp	18%	98.8M
tih_rna_sample_00124_B23WHTKLT4_2_trimmed_2																																																			75.3%	54%	131bp	147bp	9%	98.8M	75.3%	54%	131bp	147bp	9%	98.8M
tih_rna_sample_00136_B23WHTKLT4_1	No	0.00%	151.0bp	139.0bp	0.01%	1.46%	0.33%	0.00%	0.01%	4.69%	0.54%	0.00%	9999000000	103824470	197356716	0.01%	0.49%	100600976	0.93%	0.96%	0.06%	0.04%	93916302	47470354	5683336	2118946	179.89	88.00	0.66%	0.47%	0.98	0.000				165bp	331bp	49.3%	0.0%	96.8%	89.7%	95.8%	94.6M	33.5%	97.5%	25213.1Mb	197.4M	54.8%	98.7%	54.4%
tih_rna_sample_00136_B23WHTKLT4_1_1																																	151.0bp	97.9%	96.6M																86.0%	53%	151bp	151bp	18%	265.8M
tih_rna_sample_00136_B23WHTKLT4_1_2																																																			85.1%	54%	151bp	151bp	18%	265.8M
tih_rna_sample_00136_B23WHTKLT4_1_trimmed_1																																																			75.1%	54%	131bp	142bp	18%	98.7M	75.1%	54%	131bp	142bp	18%	98.7M
tih_rna_sample_00136_B23WHTKLT4_1_trimmed_2																																																			75.7%	55%	131bp	142bp	9%	98.7M	75.7%	55%	131bp	142bp	9%	98.7M
tih_rna_sample_00136_B23WHTKLT4_2	No	0.00%	148.1bp	136.0bp	0.01%	1.47%	0.33%	0.00%	0.01%	4.73%	0.55%	0.00%	9999000000	160543921	197253660	0.01%	0.39%	120972357	0.94%	0.96%	0.05%	0.04%	113620259	57394019	6339980	2343714	216.89	105.00	0.68%	0.51%	0.98	0.000				159bp	309bp	38.9%	0.0%	96.8%	89.4%	95.8%	94.5M	25.0%	97.5%	24862.7Mb	197.3M	55.2%	98.6%	56.3%
tih_rna_sample_00136_B23WHTKLT4_2_1																																	148.1bp	97.9%	96.6M																83.7%	54%	151bp	151bp	18%	269.7M
tih_rna_sample_00136_B23WHTKLT4_2_2																																																			82.8%	55%	151bp	151bp	18%	269.7M
tih_rna_sample_00136_B23WHTKLT4_2_trimmed_1																																																			72.5%	54%	129bp	142bp	18%	98.6M	72.5%	54%	129bp	142bp	18%	98.6M
tih_rna_sample_00136_B23WHTKLT4_2_trimmed_2																																																			73.1%	55%	129bp	142bp	9%	98.6M	73.1%	55%	129bp	142bp	9%	98.6M
tih_rna_sample_00145_B23WHTKLT4_1	No	0.00%	137.7bp	129.0bp	0.01%	0.86%	0.45%	0.00%	0.01%	2.68%	0.71%	0.00%	9999000000	67060207	197176112	0.01%	0.64%	70675816	0.93%	0.96%	0.06%	0.04%	65692989	33107806	3904454	1519398	114.29	51.00	0.59%	0.34%	0.98	0.000				160bp	343bp	64.5%	0.0%	97.3%	89.3%	95.6%	94.3M	44.8%	97.4%	24522.1Mb	197.2M	55.8%	98.6%	62.9%
tih_rna_sample_00145_B23WHTKLT4_1_1																																	137.7bp	98.3%	96.9M																91.0%	55%	151bp	151bp	18%	338.4M
tih_rna_sample_00145_B23WHTKLT4_1_2																																																			89.9%	55%	151bp	151bp	18%	338.4M
tih_rna_sample_00145_B23WHTKLT4_1_trimmed_1																																																			80.5%	55%	128bp	137bp	18%	98.6M	80.5%	55%	128bp	137bp	18%	98.6M
tih_rna_sample_00145_B23WHTKLT4_1_trimmed_2																																																			80.7%	55%	128bp	137bp	9%	98.6M	80.7%	55%	128bp	137bp	9%	98.6M
tih_rna_sample_00145_B23WHTKLT4_2	No	0.00%	127.6bp	118.0bp	0.01%	0.91%	0.46%	0.00%	0.02%	2.79%	0.74%	0.00%	9999000000	102549740	197091996	0.01%	0.50%	99082184	0.94%	0.96%	0.05%	0.04%	93279570	46966291	4724348	1829036	158.02	72.00	0.64%	0.43%	0.98	0.000				139bp	268bp	50.0%	0.0%	97.4%	88.6%	95.4%	94.0M	29.8%	97.5%	23264.8Mb	197.1M	56.2%	98.5%	70.1%
tih_rna_sample_00145_B23WHTKLT4_2_1																																	127.6bp	98.3%	96.9M																87.2%	54%	151bp	151bp	18%	295.8M
tih_rna_sample_00145_B23WHTKLT4_2_2																																																			86.2%	55%	151bp	151bp	18%	295.8M
tih_rna_sample_00145_B23WHTKLT4_2_trimmed_1																																																			75.8%	55%	121bp	122bp	18%	98.5M	75.8%	55%	121bp	122bp	18%	98.5M
tih_rna_sample_00145_B23WHTKLT4_2_trimmed_2																																																			76.5%	56%	121bp	122bp	9%	98.5M	76.5%	56%	121bp	122bp	9%	98.5M
tih_rna_sample_00146_B23WHTKLT4_1	No	0.00%	166.9bp	151.0bp	0.00%	0.53%	0.39%	0.00%	0.01%	1.76%	0.62%	0.00%	9999000000	140000270	197309064	0.01%	0.43%	112971034	0.94%	0.97%	0.05%	0.03%	106451744	54026942	5485934	1673308	223.30	106.00	0.68%	0.51%	0.97	0.000				231bp	569bp	43.0%	0.0%	96.8%	91.6%	96.5%	95.2M	29.5%	97.4%	26166.4Mb	197.3M	55.7%	98.7%	43.2%
tih_rna_sample_00146_B23WHTKLT4_1_1																																	166.9bp	97.8%	96.5M																87.6%	55%	151bp	151bp	18%	325.3M
tih_rna_sample_00146_B23WHTKLT4_1_2																																																			86.9%	55%	151bp	151bp	18%	325.3M
tih_rna_sample_00146_B23WHTKLT4_1_trimmed_1																																																			76.0%	55%	136bp	151bp	18%	98.7M	76.0%	55%	136bp	151bp	18%	98.7M
tih_rna_sample_00146_B23WHTKLT4_1_trimmed_2																																																			76.8%	56%	136bp	151bp	9%	98.7M	76.8%	56%	136bp	151bp	9%	98.7M
tih_rna_sample_00146_B23WHTKLT4_2	No	0.00%	161.4bp	146.0bp	0.01%	0.55%	0.39%	0.00%	0.01%	1.83%	0.62%	0.00%	9999000000	214388148	197426438	0.01%	0.35%	128686177	0.95%	0.97%	0.05%	0.03%	121728816	61742515	5932928	1821782	251.60	120.00	0.69%	0.54%	0.97	0.000				217bp	527bp	35.0%	0.0%	96.8%	91.5%	96.5%	95.2M	23.8%	97.4%	25707.4Mb	197.4M	55.6%	98.7%	46.4%
tih_rna_sample_00146_B23WHTKLT4_2_1																																	161.4bp	97.7%	96.5M																87.4%	54%	151bp	151bp	18%	399.3M
tih_rna_sample_00146_B23WHTKLT4_2_2																																																			86.8%	55%	151bp	151bp	18%	399.3M
tih_rna_sample_00146_B23WHTKLT4_2_trimmed_1																																																			74.5%	55%	134bp	151bp	18%	98.7M	74.5%	55%	134bp	151bp	18%	98.7M
tih_rna_sample_00146_B23WHTKLT4_2_trimmed_2																																																			75.4%	55%	134bp	151bp	9%	98.7M	75.4%	55%	134bp	151bp	9%	98.7M
tih_rna_sample_00149_B23WHTKLT4_1	No	0.00%	138.4bp	129.0bp	0.01%	0.94%	0.35%	0.00%	0.02%	2.90%	0.57%	0.00%	9999000000	82357233	197181704	0.00%	0.55%	89386516	0.93%	0.96%	0.06%	0.04%	83442336	42101593	5047989	1947262	148.57	65.00	0.62%	0.41%	0.98	0.000				147bp	288bp	54.9%	0.0%	96.8%	90.2%	96.0%	94.7M	35.9%	97.5%	24346.4Mb	197.2M	54.0%	98.6%	62.6%
tih_rna_sample_00149_B23WHTKLT4_1_1																																	138.4bp	98.0%	96.6M																86.5%	53%	151bp	151bp	18%	236.2M
tih_rna_sample_00149_B23WHTKLT4_1_2																																																			85.7%	54%	151bp	151bp	18%	236.2M
tih_rna_sample_00149_B23WHTKLT4_1_trimmed_1																																																			77.2%	53%	127bp	132bp	18%	98.6M	77.2%	53%	127bp	132bp	18%	98.6M
tih_rna_sample_00149_B23WHTKLT4_1_trimmed_2																																																			77.7%	54%	127bp	132bp	9%	98.6M	77.7%	54%	127bp	132bp	9%	98.6M
tih_rna_sample_00149_B23WHTKLT4_2	No	0.00%	139.2bp	129.0bp	0.01%	0.95%	0.36%	0.00%	0.02%	2.92%	0.57%	0.00%	9999000000	138206035	197424994	0.00%	0.42%	113675658	0.94%	0.96%	0.05%	0.04%	107023739	53998405	5762277	2174487	194.02	87.00	0.65%	0.47%	0.98	0.000				148bp	291bp	42.6%	0.0%	96.8%	90.1%	96.0%	94.8M	27.5%	97.5%	24468.8Mb	197.4M	54.0%	98.7%	62.3%
tih_rna_sample_00149_B23WHTKLT4_2_1																																	139.2bp	97.9%	96.6M																84.3%	53%	151bp	151bp	18%	254.7M
tih_rna_sample_00149_B23WHTKLT4_2_2																																																			83.5%	54%	151bp	151bp	18%	254.7M
tih_rna_sample_00149_B23WHTKLT4_2_trimmed_1																																																			73.9%	53%	127bp	132bp	18%	98.7M	73.9%	53%	127bp	132bp	18%	98.7M
tih_rna_sample_00149_B23WHTKLT4_2_trimmed_2																																																			74.4%	54%	127bp	137bp	9%	98.7M	74.4%	54%	127bp	137bp	9%	98.7M
tih_rna_sample_00150_B23WHTKLT4_1	No	0.00%	147.4bp	134.0bp	0.01%	1.24%	0.54%	0.00%	0.02%	3.45%	0.75%	0.00%	9999000000	125449767	196997344	0.00%	0.45%	109135723	0.95%	0.97%	0.05%	0.03%	103165399	52165459	5113201	1715244	195.84	73.00	0.62%	0.44%	0.98	0.000				173bp	461bp	44.8%	0.0%	97.6%	91.5%	96.5%	95.0M	29.3%	97.5%	24694.1Mb	197.0M	54.0%	98.5%	57.0%
tih_rna_sample_00150_B23WHTKLT4_1_1																																	147.4bp	98.2%	96.7M																86.2%	53%	151bp	151bp	18%	251.5M
tih_rna_sample_00150_B23WHTKLT4_1_2																																																			85.4%	54%	151bp	151bp	18%	251.5M
tih_rna_sample_00150_B23WHTKLT4_1_trimmed_1																																																			76.9%	53%	128bp	142bp	18%	98.5M	76.9%	53%	128bp	142bp	18%	98.5M
tih_rna_sample_00150_B23WHTKLT4_1_trimmed_2																																																			77.8%	54%	129bp	142bp	9%	98.5M	77.8%	54%	129bp	142bp	9%	98.5M
tih_rna_sample_00150_B23WHTKLT4_2	No	0.00%	147.8bp	135.0bp	0.01%	1.25%	0.54%	0.00%	0.03%	3.46%	0.75%	0.00%	9999000000	226368929	197348564	0.00%	0.34%	130920873	0.95%	0.97%	0.04%	0.03%	124362808	62916231	5669015	1843300	241.37	90.00	0.65%	0.48%	0.98	0.000				176bp	471bp	33.8%	0.0%	97.7%	91.4%	96.5%	95.2M	21.6%	97.5%	24906.8Mb	197.3M	54.5%	98.7%	56.1%
tih_rna_sample_00150_B23WHTKLT4_2_1																																	147.8bp	98.2%	96.9M																87.2%	53%	151bp	151bp	18%	390.3M
tih_rna_sample_00150_B23WHTKLT4_2_2																																																			86.5%	54%	151bp	151bp	18%	390.3M
tih_rna_sample_00150_B23WHTKLT4_2_trimmed_1																																																			75.0%	54%	129bp	142bp	18%	98.7M	75.0%	54%	129bp	142bp	18%	98.7M
tih_rna_sample_00150_B23WHTKLT4_2_trimmed_2																																																			75.8%	54%	129bp	142bp	9%	98.7M	75.8%	54%	129bp	142bp	9%	98.7M
tih_rna_sample_00158_B23WHTKLT4_1	No	0.00%	154.7bp	140.0bp	0.02%	1.41%	0.52%	0.00%	0.04%	4.10%	0.78%	0.00%	9999000000	59426655	197019552	0.01%	0.68%	62349057	0.91%	0.95%	0.07%	0.05%	56896373	28850470	4318022	1555861	110.05	41.00	0.56%	0.31%	0.97	0.000				180bp	380bp	68.7%	0.0%	97.1%	87.5%	95.1%	93.7M	49.3%	97.3%	25369.3Mb	197.0M	58.1%	98.5%	50.8%
tih_rna_sample_00158_B23WHTKLT4_1_1																																	154.7bp	97.7%	96.2M																89.8%	57%	151bp	151bp	18%	224.8M
tih_rna_sample_00158_B23WHTKLT4_1_2																																																			88.3%	57%	151bp	151bp	18%	224.8M
tih_rna_sample_00158_B23WHTKLT4_1_trimmed_1																																																			82.6%	57%	132bp	147bp	18%	98.5M	82.6%	57%	132bp	147bp	18%	98.5M
tih_rna_sample_00158_B23WHTKLT4_1_trimmed_2																																																			82.6%	58%	132bp	147bp	9%	98.5M	82.6%	58%	132bp	147bp	9%	98.5M
tih_rna_sample_00158_B23WHTKLT4_2	No	0.00%	150.7bp	136.0bp	0.03%	1.45%	0.53%	0.00%	0.05%	4.20%	0.78%	0.00%	9999000000	73127626	196250080	0.01%	0.59%	81430812	0.93%	0.96%	0.06%	0.04%	75338150	38131264	4957916	1741695	143.64	56.00	0.60%	0.38%	0.97	0.000				170bp	355bp	58.8%	0.0%	97.0%	87.1%	95.0%	93.2M	39.5%	97.2%	24712.1Mb	196.3M	57.9%	98.1%	53.7%
tih_rna_sample_00158_B23WHTKLT4_2_1																																	150.7bp	97.8%	95.9M																85.2%	56%	151bp	151bp	18%	163.0M
tih_rna_sample_00158_B23WHTKLT4_2_2																																																			84.1%	57%	151bp	151bp	18%	163.0M
tih_rna_sample_00158_B23WHTKLT4_2_trimmed_1																																																			79.8%	57%	129bp	142bp	9%	98.1M	79.8%	57%	129bp	142bp	9%	98.1M
tih_rna_sample_00158_B23WHTKLT4_2_trimmed_2																																																			80.4%	58%	130bp	142bp	9%	98.1M	80.4%	58%	130bp	142bp	9%	98.1M
tih_rna_sample_00161_B23WHTKLT4_1	No	0.00%	137.5bp	127.0bp	0.01%	0.88%	0.45%	0.00%	0.01%	2.83%	0.72%	0.00%	9999000000	79226294	197278114	0.00%	0.58%	83319417	0.94%	0.96%	0.05%	0.04%	77991865	39349313	4402889	1655843	138.64	58.00	0.61%	0.38%	0.97	0.000				153bp	311bp	58.0%	0.0%	97.3%	89.4%	96.0%	94.7M	37.7%	97.3%	24176.9Mb	197.3M	56.0%	98.6%	63.3%
tih_rna_sample_00161_B23WHTKLT4_1_1																																	137.5bp	98.3%	96.9M																89.0%	55%	151bp	151bp	18%	293.8M
tih_rna_sample_00161_B23WHTKLT4_1_2																																																			87.9%	55%	151bp	151bp	18%	293.8M
tih_rna_sample_00161_B23WHTKLT4_1_trimmed_1																																																			78.4%	55%	126bp	132bp	18%	98.6M	78.4%	55%	126bp	132bp	18%	98.6M
tih_rna_sample_00161_B23WHTKLT4_1_trimmed_2																																																			78.9%	56%	126bp	132bp	9%	98.6M	78.9%	56%	126bp	132bp	9%	98.6M
tih_rna_sample_00161_B23WHTKLT4_2	No	0.00%	142.7bp	132.0bp	0.01%	0.87%	0.44%	0.00%	0.01%	2.83%	0.71%	0.00%	9999000000	113810375	197229806	0.00%	0.47%	104106129	0.94%	0.96%	0.05%	0.04%	98139387	49550739	5028336	1811167	182.03	78.00	0.65%	0.45%	0.98	0.000				163bp	345bp	47.4%	0.0%	97.2%	89.4%	96.0%	94.7M	30.9%	97.5%	24660.1Mb	197.2M	55.9%	98.6%	59.9%
tih_rna_sample_00161_B23WHTKLT4_2_1																																	142.7bp	98.2%	96.8M																88.7%	55%	151bp	151bp	18%	377.6M
tih_rna_sample_00161_B23WHTKLT4_2_2																																																			87.7%	55%	151bp	151bp	18%	377.6M
tih_rna_sample_00161_B23WHTKLT4_2_trimmed_1																																																			75.5%	55%	128bp	137bp	18%	98.6M	75.5%	55%	128bp	137bp	18%	98.6M
tih_rna_sample_00161_B23WHTKLT4_2_trimmed_2																																																			76.1%	56%	128bp	137bp	9%	98.6M	76.1%	56%	128bp	137bp	9%	98.6M
tih_rna_sample_00163_B23WHTKLT4_1	No	0.00%	155.1bp	142.0bp	0.01%	1.30%	0.41%	0.00%	0.02%	4.09%	0.66%	0.00%	9999000000	119458847	197290982	0.00%	0.46%	106085817	0.94%	0.97%	0.05%	0.03%	99971865	50610499	5229261	1757542	197.41	88.00	0.66%	0.48%	0.98	0.000				192bp	441bp	46.4%	0.0%	96.9%	90.6%	96.2%	94.9M	31.8%	97.5%	25424.6Mb	197.3M	54.8%	98.6%	51.3%
tih_rna_sample_00163_B23WHTKLT4_1_1																																	155.1bp	98.1%	96.8M																83.2%	54%	151bp	151bp	18%	188.9M
tih_rna_sample_00163_B23WHTKLT4_1_2																																																			82.4%	54%	151bp	151bp	18%	188.9M
tih_rna_sample_00163_B23WHTKLT4_1_trimmed_1																																																			76.1%	54%	132bp	147bp	9%	98.6M	76.1%	54%	132bp	147bp	9%	98.6M
tih_rna_sample_00163_B23WHTKLT4_1_trimmed_2																																																			76.6%	55%	132bp	147bp	9%	98.6M	76.6%	55%	132bp	147bp	9%	98.6M
tih_rna_sample_00163_B23WHTKLT4_2	No	0.00%	150.0bp	135.0bp	0.01%	1.36%	0.42%	0.00%	0.02%	4.24%	0.68%	0.00%	9999000000	162572833	196803432	0.00%	0.40%	118862184	0.94%	0.97%	0.05%	0.03%	112311234	56797246	5620349	1890901	217.99	98.00	0.67%	0.50%	0.98	0.000				181bp	409bp	39.8%	0.0%	96.9%	90.3%	96.1%	94.6M	25.9%	97.5%	24841.3Mb	196.8M	54.6%	98.4%	54.1%
tih_rna_sample_00163_B23WHTKLT4_2_1																																	150.0bp	98.1%	96.6M																86.6%	54%	151bp	151bp	18%	324.4M
tih_rna_sample_00163_B23WHTKLT4_2_2																																																			85.7%	54%	151bp	151bp	18%	324.4M
tih_rna_sample_00163_B23WHTKLT4_2_trimmed_1																																																			74.8%	54%	129bp	142bp	18%	98.4M	74.8%	54%	129bp	142bp	18%	98.4M
tih_rna_sample_00163_B23WHTKLT4_2_trimmed_2																																																			75.7%	54%	129bp	142bp	9%	98.4M	75.7%	54%	129bp	142bp	9%	98.4M
tih_rna_sample_00164_B23WHTKLT4_1	No	0.00%	135.5bp	126.0bp	0.01%	0.83%	0.43%	0.00%	0.02%	2.48%	0.65%	0.00%	9999000000	40251385	196771104	0.01%	0.76%	46579566	0.90%	0.94%	0.07%	0.06%	41959019	21168572	3256146	1281208	71.38	25.00	0.47%	0.19%	0.98	0.000				146bp	280bp	76.9%	0.0%	97.7%	87.8%	95.4%	93.9M	51.9%	97.4%	24045.1Mb	196.8M	56.8%	98.4%	64.8%
tih_rna_sample_00164_B23WHTKLT4_1_1																																	135.5bp	98.2%	96.6M																91.7%	55%	151bp	151bp	18%	251.4M
tih_rna_sample_00164_B23WHTKLT4_1_2																																																			90.1%	56%	151bp	151bp	18%	251.4M
tih_rna_sample_00164_B23WHTKLT4_1_trimmed_1																																																			84.7%	56%	125bp	132bp	18%	98.4M	84.7%	56%	125bp	132bp	18%	98.4M
tih_rna_sample_00164_B23WHTKLT4_1_trimmed_2																																																			84.4%	57%	125bp	132bp	9%	98.4M	84.4%	57%	125bp	132bp	9%	98.4M
tih_rna_sample_00164_B23WHTKLT4_2	No	0.00%	133.2bp	124.0bp	0.01%	0.80%	0.40%	0.00%	0.02%	2.38%	0.61%	0.00%	9999000000	44643227	196758602	0.01%	0.74%	51002658	0.90%	0.94%	0.07%	0.06%	45724878	23071928	3726348	1469361	77.49	26.00	0.48%	0.20%	0.97	0.000				142bp	261bp	74.7%	0.0%	97.4%	85.5%	94.9%	93.3M	48.2%	97.3%	23755.2Mb	196.8M	57.1%	98.4%	66.4%
tih_rna_sample_00164_B23WHTKLT4_2_1																																	133.2bp	97.9%	96.3M																86.9%	55%	151bp	151bp	18%	136.5M
tih_rna_sample_00164_B23WHTKLT4_2_2																																																			85.5%	56%	151bp	151bp	18%	136.5M
tih_rna_sample_00164_B23WHTKLT4_2_trimmed_1																																																			83.9%	56%	124bp	127bp	9%	98.4M	83.9%	56%	124bp	127bp	9%	98.4M
tih_rna_sample_00164_B23WHTKLT4_2_trimmed_2																																																			83.6%	57%	124bp	127bp	9%	98.4M	83.6%	57%	124bp	127bp	9%	98.4M
tih_rna_sample_00166_B23WHTKLT4_1	No	0.00%	148.0bp	135.0bp	0.01%	0.97%	0.41%	0.00%	0.01%	3.13%	0.67%	0.00%	9999000000	83693808	196921124	0.00%	0.54%	89967378	0.94%	0.97%	0.05%	0.03%	84820806	42844172	4242461	1452094	161.83	73.00	0.64%	0.44%	0.98	0.000				178bp	419bp	54.6%	0.0%	97.5%	90.6%	96.1%	94.6M	37.9%	97.5%	24994.3Mb	196.9M	54.0%	98.5%	54.7%
tih_rna_sample_00166_B23WHTKLT4_1_1																																	148.0bp	98.4%	96.9M																89.4%	53%	151bp	151bp	18%	312.5M
tih_rna_sample_00166_B23WHTKLT4_1_2																																																			88.2%	53%	151bp	151bp	18%	312.5M
tih_rna_sample_00166_B23WHTKLT4_1_trimmed_1																																																			78.4%	53%	130bp	142bp	18%	98.5M	78.4%	53%	130bp	142bp	18%	98.5M
tih_rna_sample_00166_B23WHTKLT4_1_trimmed_2																																																			79.2%	54%	130bp	142bp	9%	98.5M	79.2%	54%	130bp	142bp	9%	98.5M
tih_rna_sample_00166_B23WHTKLT4_2	No	0.00%	146.4bp	134.0bp	0.01%	0.97%	0.41%	0.00%	0.02%	3.13%	0.67%	0.00%	9999000000	151971117	197536224	0.00%	0.41%	117061127	0.95%	0.97%	0.04%	0.03%	111265630	56210192	4894768	1636290	214.40	99.00	0.67%	0.50%	0.98	0.000				171bp	388bp	40.9%	0.0%	97.6%	90.5%	96.1%	94.9M	26.7%	97.5%	24889.0Mb	197.5M	54.6%	98.8%	56.4%
tih_rna_sample_00166_B23WHTKLT4_2_1																																	146.4bp	98.4%	97.2M																84.4%	54%	151bp	151bp	18%	232.1M
tih_rna_sample_00166_B23WHTKLT4_2_2																																																			84.0%	54%	151bp	151bp	18%	232.1M
tih_rna_sample_00166_B23WHTKLT4_2_trimmed_1																																																			75.5%	54%	129bp	142bp	18%	98.8M	75.5%	54%	129bp	142bp	18%	98.8M
tih_rna_sample_00166_B23WHTKLT4_2_trimmed_2																																																			76.3%	54%	129bp	142bp	9%	98.8M	76.3%	54%	129bp	142bp	9%	98.8M
tih_rna_sample_00434_B23WHTKLT4_1	No	0.00%	135.7bp	125.0bp	0.01%	1.16%	0.50%	0.00%	0.01%	3.45%	0.74%	0.00%	9999000000	87587759	197115998	0.00%	0.53%	92165044	0.94%	0.96%	0.05%	0.04%	86736307	43728485	4559823	1703048	156.18	74.00	0.64%	0.43%	0.97	0.000				144bp	285bp	53.5%	0.0%	97.5%	89.7%	95.8%	94.4M	32.7%	97.3%	23841.3Mb	197.1M	55.6%	98.6%	63.8%
tih_rna_sample_00434_B23WHTKLT4_1_1																																	135.7bp	98.4%	97.0M																90.6%	54%	151bp	151bp	18%	420.8M
tih_rna_sample_00434_B23WHTKLT4_1_2																																																			89.5%	55%	151bp	151bp	18%	420.8M
tih_rna_sample_00434_B23WHTKLT4_1_trimmed_1																																																			77.1%	55%	124bp	132bp	18%	98.6M	77.1%	55%	124bp	132bp	18%	98.6M
tih_rna_sample_00434_B23WHTKLT4_1_trimmed_2																																																			77.8%	55%	124bp	132bp	9%	98.6M	77.8%	55%	124bp	132bp	9%	98.6M
tih_rna_sample_00434_B23WHTKLT4_2	No	0.00%	144.4bp	133.0bp	0.01%	1.14%	0.48%	0.00%	0.02%	3.43%	0.72%	0.00%	9999000000	151296522	197283146	0.00%	0.40%	118492298	0.95%	0.97%	0.04%	0.03%	112422535	56765330	5203338	1818978	212.29	105.00	0.68%	0.51%	0.98	0.000				159bp	351bp	40.1%	0.0%	97.3%	90.0%	95.8%	94.5M	25.8%	97.5%	24619.2Mb	197.3M	54.6%	98.6%	58.3%
tih_rna_sample_00434_B23WHTKLT4_2_1																																	144.4bp	98.4%	97.0M																88.4%	53%	151bp	151bp	18%	412.3M
tih_rna_sample_00434_B23WHTKLT4_2_2																																																			87.5%	54%	151bp	151bp	18%	412.3M
tih_rna_sample_00434_B23WHTKLT4_2_trimmed_1																																																			74.5%	54%	128bp	137bp	18%	98.6M	74.5%	54%	128bp	137bp	18%	98.6M
tih_rna_sample_00434_B23WHTKLT4_2_trimmed_2																																																			75.3%	54%	128bp	137bp	9%	98.6M	75.3%	54%	128bp	137bp	9%	98.6M
tih_rna_sample_00451_B23WHTKLT4_1	No	0.00%	137.9bp	128.0bp	0.01%	0.69%	0.41%	0.00%	0.01%	2.16%	0.61%	0.00%	9999000000	130412427	197388310	0.01%	0.43%	113018178	0.94%	0.96%	0.05%	0.04%	106271729	53617711	5679620	2139399	192.13	109.00	0.71%	0.52%	0.98	0.000				148bp	293bp	43.0%	0.0%	96.9%	89.4%	95.7%	94.4M	27.7%	97.5%	24390.2Mb	197.4M	53.9%	98.7%	62.2%
tih_rna_sample_00451_B23WHTKLT4_1_1																																	137.9bp	98.0%	96.7M																85.4%	53%	151bp	151bp	18%	290.5M
tih_rna_sample_00451_B23WHTKLT4_1_2																																																			84.7%	54%	151bp	151bp	18%	290.5M
tih_rna_sample_00451_B23WHTKLT4_1_trimmed_1																																																			73.4%	53%	127bp	132bp	18%	98.7M	73.4%	53%	127bp	132bp	18%	98.7M
tih_rna_sample_00451_B23WHTKLT4_1_trimmed_2																																																			74.2%	54%	127bp	132bp	9%	98.7M	74.2%	54%	127bp	132bp	9%	98.7M
tih_rna_sample_00451_B23WHTKLT4_2	No	0.00%	137.6bp	127.0bp	0.01%	0.70%	0.42%	0.00%	0.01%	2.19%	0.61%	0.00%	9999000000	218965264	197381928	0.01%	0.33%	132906637	0.94%	0.96%	0.05%	0.04%	125566860	63325362	6223044	2323884	226.98	128.00	0.73%	0.56%	0.98	0.000				144bp	277bp	32.9%	0.0%	96.9%	89.1%	95.5%	94.3M	20.3%	97.5%	24142.8Mb	197.4M	54.1%	98.7%	63.6%
tih_rna_sample_00451_B23WHTKLT4_2_1																																	137.6bp	98.0%	96.7M																78.0%	53%	151bp	151bp	18%	174.9M
tih_rna_sample_00451_B23WHTKLT4_2_2																																																			77.4%	53%	151bp	151bp	18%	174.9M
tih_rna_sample_00451_B23WHTKLT4_2_trimmed_1																																																			71.3%	53%	125bp	132bp	9%	98.7M	71.3%	53%	125bp	132bp	9%	98.7M
tih_rna_sample_00451_B23WHTKLT4_2_trimmed_2																																																			71.7%	54%	126bp	132bp	9%	98.7M	71.7%	54%	126bp	132bp	9%	98.7M
tih_rna_sample_00457_B23WHTKLT4_1	No	0.00%	152.9bp	139.0bp	0.01%	0.68%	0.36%	0.00%	0.01%	2.23%	0.57%	0.00%	9999000000	113330461	197111060	0.00%	0.47%	103605937	0.95%	0.97%	0.04%	0.03%	98150270	49630147	4491755	1444582	193.29	82.00	0.66%	0.46%	0.97	0.000				193bp	473bp	47.7%	0.0%	97.7%	91.3%	96.4%	95.0M	31.8%	97.4%	25152.1Mb	197.1M	55.7%	98.6%	52.8%
tih_rna_sample_00457_B23WHTKLT4_1_1																																	152.9bp	98.4%	97.0M																90.3%	55%	151bp	151bp	18%	405.7M
tih_rna_sample_00457_B23WHTKLT4_1_2																																																			89.2%	55%	151bp	151bp	18%	405.7M
tih_rna_sample_00457_B23WHTKLT4_1_trimmed_1																																																			77.7%	55%	131bp	147bp	18%	98.6M	77.7%	55%	131bp	147bp	18%	98.6M
tih_rna_sample_00457_B23WHTKLT4_1_trimmed_2																																																			78.3%	55%	131bp	147bp	9%	98.6M	78.3%	55%	131bp	147bp	9%	98.6M
tih_rna_sample_00457_B23WHTKLT4_2	No	0.00%	151.0bp	138.0bp	0.01%	0.67%	0.36%	0.00%	0.01%	2.21%	0.58%	0.00%	9999000000	143093645	197319360	0.01%	0.42%	114568396	0.95%	0.97%	0.04%	0.03%	108844645	55033132	4736577	1509369	214.29	89.00	0.67%	0.47%	0.98	0.000				188bp	450bp	42.1%	0.0%	97.7%	91.0%	96.3%	95.0M	28.3%	97.5%	25134.1Mb	197.3M	56.2%	98.7%	53.7%
tih_rna_sample_00457_B23WHTKLT4_2_1																																	151.0bp	98.4%	97.1M																87.2%	55%	151bp	151bp	18%	306.4M
tih_rna_sample_00457_B23WHTKLT4_2_2																																																			86.3%	56%	151bp	151bp	18%	306.4M
tih_rna_sample_00457_B23WHTKLT4_2_trimmed_1																																																			76.5%	55%	131bp	147bp	18%	98.7M	76.5%	55%	131bp	147bp	18%	98.7M
tih_rna_sample_00457_B23WHTKLT4_2_trimmed_2																																																			77.0%	56%	131bp	147bp	9%	98.7M	77.0%	56%	131bp	147bp	9%	98.7M
tih_rna_sample_00461_B23WHTKLT4_1	No	0.00%	155.7bp	142.0bp	0.01%	0.96%	0.48%	0.00%	0.02%	2.84%	0.69%	0.00%	9999000000	9450203	101224170	0.00%	0.92%	8254201	0.82%	0.89%	0.13%	0.11%	6764310	3421303	1057314	426391	12.41	4.00	0.10%	0.01%	0.97	0.000				185bp	449bp	92.2%	0.0%	97.2%	89.5%	96.0%	48.6M	69.2%	97.4%	13019.3Mb	101.2M	54.6%	97.3%	52.3%
tih_rna_sample_00461_B23WHTKLT4_1_1																																	155.7bp	98.2%	49.7M																91.9%	54%	151bp	151bp	18%	52.0M
tih_rna_sample_00461_B23WHTKLT4_1_2																																																			90.2%	55%	151bp	151bp	27%	52.0M
tih_rna_sample_00461_B23WHTKLT4_1_trimmed_1																																																			91.9%	54%	132bp	147bp	9%	50.6M	91.9%	54%	132bp	147bp	9%	50.6M
tih_rna_sample_00461_B23WHTKLT4_1_trimmed_2																																																			91.5%	54%	132bp	147bp	9%	50.6M	91.5%	54%	132bp	147bp	9%	50.6M
tih_rna_sample_00461_B23WHTKLT4_2	No	0.00%	147.2bp	134.0bp	0.02%	1.06%	0.49%	0.00%	0.04%	3.11%	0.71%	0.00%	9999000000	208258602	196525974	0.00%	0.34%	129792187	0.95%	0.97%	0.05%	0.03%	122881203	62114104	6036965	2014365	236.88	93.00	0.63%	0.49%	0.97	0.000				169bp	395bp	34.1%	0.0%	97.1%	89.1%	95.8%	94.1M	21.9%	97.4%	24640.8Mb	196.5M	54.2%	98.3%	56.0%
tih_rna_sample_00461_B23WHTKLT4_2_1																																	147.2bp	98.2%	96.5M																82.1%	53%	151bp	151bp	18%	195.6M
tih_rna_sample_00461_B23WHTKLT4_2_2																																																			81.6%	54%	151bp	151bp	18%	195.6M
tih_rna_sample_00461_B23WHTKLT4_2_trimmed_1																																																			75.0%	53%	129bp	142bp	9%	98.3M	75.0%	53%	129bp	142bp	9%	98.3M
tih_rna_sample_00461_B23WHTKLT4_2_trimmed_2																																																			76.1%	54%	129bp	142bp	9%	98.3M	76.1%	54%	129bp	142bp	9%	98.3M
tih_rna_sample_00462_B23WHTKLT4_1	No	0.00%	154.8bp	140.0bp	0.00%	0.76%	0.65%	0.00%	0.01%	2.41%	0.89%	0.00%	9999000000	125807251	197153030	0.00%	0.45%	108918672	0.95%	0.97%	0.04%	0.03%	103600301	52404734	4460539	1377796	206.48	78.00	0.62%	0.46%	0.98	0.000				208bp	549bp	44.9%	0.0%	97.6%	92.4%	96.8%	95.4M	30.3%	97.5%	25326.6Mb	197.2M	54.7%	98.6%	51.3%
tih_rna_sample_00462_B23WHTKLT4_1_1																																	154.8bp	98.4%	97.0M																90.4%	54%	151bp	151bp	18%	431.1M
tih_rna_sample_00462_B23WHTKLT4_1_2																																																			89.3%	54%	151bp	151bp	18%	431.1M
tih_rna_sample_00462_B23WHTKLT4_1_trimmed_1																																																			77.6%	54%	132bp	147bp	18%	98.6M	77.6%	54%	132bp	147bp	18%	98.6M
tih_rna_sample_00462_B23WHTKLT4_1_trimmed_2																																																			78.5%	54%	132bp	147bp	9%	98.6M	78.5%	54%	132bp	147bp	9%	98.6M
tih_rna_sample_00462_B23WHTKLT4_2	No	0.00%	158.7bp	145.0bp	0.00%	0.75%	0.65%	0.00%	0.01%	2.37%	0.90%	0.00%	9999000000	220369389	197410394	0.00%	0.35%	128286403	0.95%	0.98%	0.04%	0.02%	122469687	61969097	4946338	1474227	251.57	96.00	0.64%	0.49%	0.98	0.000				222bp	600bp	35.2%	0.0%	97.6%	92.5%	96.8%	95.5M	24.1%	97.5%	25766.3Mb	197.4M	54.8%	98.7%	48.6%
tih_rna_sample_00462_B23WHTKLT4_2_1																																	158.7bp	98.3%	97.0M																86.3%	54%	151bp	151bp	18%	320.2M
tih_rna_sample_00462_B23WHTKLT4_2_2																																																			85.9%	54%	151bp	151bp	18%	320.2M
tih_rna_sample_00462_B23WHTKLT4_2_trimmed_1																																																			75.6%	54%	134bp	151bp	18%	98.7M	75.6%	54%	134bp	151bp	18%	98.7M
tih_rna_sample_00462_B23WHTKLT4_2_trimmed_2																																																			76.5%	55%	134bp	151bp	9%	98.7M	76.5%	55%	134bp	151bp	9%	98.7M
tih_rna_sample_00464_B23WHTKLT4_1	No	0.00%	138.9bp	129.0bp	0.01%	1.29%	0.55%	0.00%	0.01%	3.89%	0.82%	0.00%	9999000000	89194191	197213870	0.01%	0.55%	89118864	0.93%	0.96%	0.05%	0.04%	83291959	42038149	4770258	1797061	149.94	68.00	0.63%	0.42%	0.97	0.000				153bp	334bp	55.1%	0.0%	97.2%	90.1%	95.9%	94.6M	35.5%	97.3%	24302.0Mb	197.2M	54.0%	98.6%	61.9%
tih_rna_sample_00464_B23WHTKLT4_1_1																																	138.9bp	98.2%	96.8M																88.2%	53%	151bp	151bp	18%	278.4M
tih_rna_sample_00464_B23WHTKLT4_1_2																																																			87.2%	53%	151bp	151bp	18%	278.4M
tih_rna_sample_00464_B23WHTKLT4_1_trimmed_1																																																			77.8%	53%	127bp	132bp	18%	98.6M	77.8%	53%	127bp	132bp	18%	98.6M
tih_rna_sample_00464_B23WHTKLT4_1_trimmed_2																																																			78.2%	54%	127bp	132bp	9%	98.6M	78.2%	54%	127bp	132bp	9%	98.6M
tih_rna_sample_00464_B23WHTKLT4_2	No	0.00%	133.0bp	121.0bp	0.01%	1.35%	0.57%	0.00%	0.02%	4.02%	0.86%	0.00%	9999000000	108467397	196623952	0.01%	0.47%	103620248	0.94%	0.96%	0.05%	0.04%	97305508	49042715	5257528	1989292	170.28	79.00	0.65%	0.45%	0.98	0.000				139bp	281bp	47.6%	0.0%	97.2%	89.4%	95.7%	94.1M	28.4%	97.5%	23419.2Mb	196.6M	54.1%	98.3%	66.2%
tih_rna_sample_00464_B23WHTKLT4_2_1																																	133.0bp	98.2%	96.5M																83.6%	53%	151bp	151bp	18%	204.9M
tih_rna_sample_00464_B23WHTKLT4_2_2																																																			82.8%	54%	151bp	151bp	18%	204.9M
tih_rna_sample_00464_B23WHTKLT4_2_trimmed_1																																																			75.2%	53%	122bp	127bp	18%	98.3M	75.2%	53%	122bp	127bp	18%	98.3M
tih_rna_sample_00464_B23WHTKLT4_2_trimmed_2																																																			76.0%	54%	122bp	127bp	9%	98.3M	76.0%	54%	122bp	127bp	9%	98.3M
tih_rna_sample_00467_B23WHTKLT4_1	No	0.00%	130.5bp	123.0bp	0.01%	1.34%	0.49%	0.00%	0.01%	4.02%	0.79%	0.00%	9999000000	66251956	196911642	0.01%	0.63%	73570598	0.92%	0.94%	0.07%	0.06%	67357021	33910830	4866719	2013121	111.63	42.00	0.56%	0.30%	0.97	0.000				135bp	215bp	63.1%	0.0%	96.9%	85.2%	94.5%	93.1M	40.1%	97.2%	23525.2Mb	196.9M	58.4%	98.5%	69.6%
tih_rna_sample_00467_B23WHTKLT4_1_1																																	130.5bp	97.7%	96.2M																89.7%	57%	151bp	151bp	18%	294.0M
tih_rna_sample_00467_B23WHTKLT4_1_2																																																			88.3%	57%	151bp	151bp	18%	294.0M
tih_rna_sample_00467_B23WHTKLT4_1_trimmed_1																																																			79.7%	58%	123bp	127bp	18%	98.5M	79.7%	58%	123bp	127bp	18%	98.5M
tih_rna_sample_00467_B23WHTKLT4_1_trimmed_2																																																			79.9%	58%	123bp	127bp	9%	98.5M	79.9%	58%	123bp	127bp	9%	98.5M
tih_rna_sample_00467_B23WHTKLT4_2	No	0.00%	122.5bp	115.0bp	0.01%	1.40%	0.50%	0.00%	0.01%	4.15%	0.81%	0.00%	9999000000	112985816	196792360	0.01%	0.47%	103973157	0.93%	0.96%	0.05%	0.04%	97104074	48841633	5532305	2249362	157.30	60.00	0.62%	0.39%	0.98	0.000				124bp	188bp	47.5%	0.0%	97.0%	84.3%	94.3%	92.8M	26.3%	97.4%	22538.0Mb	196.8M	58.4%	98.4%	74.5%
tih_rna_sample_00467_B23WHTKLT4_2_1																																	122.5bp	97.8%	96.2M																87.0%	56%	151bp	151bp	18%	311.5M
tih_rna_sample_00467_B23WHTKLT4_2_2																																																			86.0%	57%	151bp	151bp	18%	311.5M
tih_rna_sample_00467_B23WHTKLT4_2_trimmed_1																																																			75.3%	58%	117bp	117bp	18%	98.4M	75.3%	58%	117bp	117bp	18%	98.4M
tih_rna_sample_00467_B23WHTKLT4_2_trimmed_2																																																			76.1%	58%	118bp	117bp	9%	98.4M	76.1%	58%	118bp	117bp	9%	98.4M
tih_rna_sample_00473_B23WHTKLT4_1	No	0.00%	152.2bp	138.0bp	0.01%	0.72%	0.53%	0.00%	0.01%	2.24%	0.77%	0.00%	9999000000	115275221	196920094	0.00%	0.47%	104290087	0.95%	0.97%	0.04%	0.03%	99205865	50134987	4203936	1312343	197.55	74.00	0.62%	0.44%	0.98	0.000				200bp	504bp	47.3%	0.0%	98.0%	90.7%	96.3%	94.8M	30.9%	97.5%	25235.7Mb	196.9M	54.9%	98.5%	51.9%
tih_rna_sample_00473_B23WHTKLT4_1_1																																	152.2bp	98.3%	96.8M																91.0%	54%	151bp	151bp	27%	482.0M
tih_rna_sample_00473_B23WHTKLT4_1_2																																																			89.8%	55%	151bp	151bp	18%	482.0M
tih_rna_sample_00473_B23WHTKLT4_1_trimmed_1																																																			77.2%	54%	131bp	147bp	18%	98.5M	77.2%	54%	131bp	147bp	18%	98.5M
tih_rna_sample_00473_B23WHTKLT4_1_trimmed_2																																																			78.3%	55%	132bp	147bp	9%	98.5M	78.3%	55%	132bp	147bp	9%	98.5M
tih_rna_sample_00473_B23WHTKLT4_2	No	0.00%	158.5bp	145.0bp	0.01%	0.70%	0.53%	0.00%	0.01%	2.21%	0.76%	0.00%	9999000000	171756555	197174132	0.00%	0.39%	119401309	0.96%	0.98%	0.04%	0.02%	114030588	57646134	4501032	1342952	234.36	89.00	0.64%	0.48%	0.98	0.000				214bp	552bp	39.6%	0.0%	98.0%	91.0%	96.4%	95.0M	26.4%	97.5%	25736.7Mb	197.2M	55.0%	98.6%	48.9%
tih_rna_sample_00473_B23WHTKLT4_2_1																																	158.5bp	98.3%	96.9M																90.2%	54%	151bp	151bp	18%	526.3M
tih_rna_sample_00473_B23WHTKLT4_2_2																																																			89.0%	55%	151bp	151bp	18%	526.3M
tih_rna_sample_00473_B23WHTKLT4_2_trimmed_1																																																			75.8%	54%	134bp	151bp	18%	98.6M	75.8%	54%	134bp	151bp	18%	98.6M
tih_rna_sample_00473_B23WHTKLT4_2_trimmed_2																																																			76.5%	55%	134bp	151bp	9%	98.6M	76.5%	55%	134bp	151bp	9%	98.6M
tih_rna_sample_00479_B23WHTKLT4_1	No	0.00%	150.9bp	139.0bp	0.01%	1.26%	0.50%	0.00%	0.01%	3.99%	0.79%	0.00%	9999000000	130932118	197252458	0.00%	0.44%	109737735	0.95%	0.97%	0.04%	0.03%	104060950	52595947	4861528	1623379	204.17	83.00	0.66%	0.46%	0.98	0.000				209bp	552bp	44.6%	0.0%	97.6%	90.6%	96.2%	94.8M	30.9%	97.5%	25328.9Mb	197.3M	54.3%	98.6%	53.5%
tih_rna_sample_00479_B23WHTKLT4_1_1																																	150.9bp	98.5%	97.1M																89.2%	53%	151bp	151bp	18%	374.1M
tih_rna_sample_00479_B23WHTKLT4_1_2																																																			88.2%	54%	151bp	151bp	18%	374.1M
tih_rna_sample_00479_B23WHTKLT4_1_trimmed_1																																																			77.1%	54%	132bp	147bp	18%	98.6M	77.1%	54%	132bp	147bp	18%	98.6M
tih_rna_sample_00479_B23WHTKLT4_1_trimmed_2																																																			77.8%	54%	132bp	147bp	9%	98.6M	77.8%	54%	132bp	147bp	9%	98.6M
tih_rna_sample_00479_B23WHTKLT4_2	No	0.00%	147.3bp	135.0bp	0.01%	1.30%	0.50%	0.00%	0.01%	4.08%	0.80%	0.00%	9999000000	215842811	197040010	0.00%	0.35%	127096156	0.95%	0.97%	0.04%	0.03%	120838740	61053118	5415528	1793557	234.86	97.00	0.68%	0.49%	0.97	0.000				194bp	497bp	35.6%	0.0%	97.6%	90.1%	96.0%	94.6M	22.7%	97.4%	24818.9Mb	197.0M	54.4%	98.5%	56.1%
tih_rna_sample_00479_B23WHTKLT4_2_1																																	147.3bp	98.4%	97.0M																81.8%	53%	151bp	151bp	18%	190.8M
tih_rna_sample_00479_B23WHTKLT4_2_2																																																			81.3%	54%	151bp	151bp	18%	190.8M
tih_rna_sample_00479_B23WHTKLT4_2_trimmed_1																																																			75.2%	54%	129bp	142bp	9%	98.5M	75.2%	54%	129bp	142bp	9%	98.5M
tih_rna_sample_00479_B23WHTKLT4_2_trimmed_2																																																			76.0%	54%	129bp	142bp	9%	98.5M	76.0%	54%	129bp	142bp	9%	98.5M
tih_rna_sample_00480_B23WHTKLT4_1	No	0.00%	147.1bp	136.0bp	0.01%	1.13%	0.47%	0.00%	0.02%	3.55%	0.70%	0.00%	9999000000	112447792	196960442	0.01%	0.49%	101315133	0.94%	0.96%	0.05%	0.04%	95141604	48050590	5163681	1859910	180.56	85.00	0.67%	0.47%	0.97	0.000				165bp	350bp	48.8%	0.0%	97.2%	89.2%	96.0%	94.5M	32.6%	97.2%	24867.6Mb	197.0M	55.0%	98.5%	56.1%
tih_rna_sample_00480_B23WHTKLT4_1_1																																	147.1bp	98.0%	96.5M																87.4%	54%	151bp	151bp	18%	287.4M
tih_rna_sample_00480_B23WHTKLT4_1_2																																																			86.4%	54%	151bp	151bp	18%	287.4M
tih_rna_sample_00480_B23WHTKLT4_1_trimmed_1																																																			76.3%	54%	130bp	142bp	18%	98.5M	76.3%	54%	130bp	142bp	18%	98.5M
tih_rna_sample_00480_B23WHTKLT4_1_trimmed_2																																																			77.1%	55%	130bp	142bp	9%	98.5M	77.1%	55%	130bp	142bp	9%	98.5M
tih_rna_sample_00480_B23WHTKLT4_2	No	0.00%	146.8bp	135.0bp	0.01%	1.16%	0.48%	0.00%	0.02%	3.63%	0.71%	0.00%	9999000000	193648163	196946194	0.01%	0.35%	127131543	0.95%	0.97%	0.05%	0.03%	120306761	60725909	5790902	2054495	229.69	110.00	0.70%	0.52%	0.97	0.000				162bp	344bp	35.6%	0.0%	97.2%	89.2%	95.9%	94.5M	23.2%	97.3%	24766.5Mb	196.9M	54.7%	98.5%	57.1%
tih_rna_sample_00480_B23WHTKLT4_2_1																																	146.8bp	98.0%	96.5M																86.2%	53%	151bp	151bp	18%	365.3M
tih_rna_sample_00480_B23WHTKLT4_2_2																																																			85.5%	54%	151bp	151bp	18%	365.3M
tih_rna_sample_00480_B23WHTKLT4_2_trimmed_1																																																			73.1%	54%	129bp	142bp	18%	98.5M	73.1%	54%	129bp	142bp	18%	98.5M
tih_rna_sample_00480_B23WHTKLT4_2_trimmed_2																																																			74.2%	54%	129bp	142bp	9%	98.5M	74.2%	54%	129bp	142bp	9%	98.5M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Custom content: SeqTools (general stats)	Reads	SeqTools (general stats) — reads	`reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Unmapped	SeqTools (general stats) — frac unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools (general stats)	Frac Dupes	SeqTools (general stats) — frac dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools (general stats)	Unique Reads	SeqTools (general stats) — unique reads	`unique_reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads On Target	SeqTools (general stats) — frac reads on target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs On Target	SeqTools (general stats) — frac pairs on target	`frac_pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads Off Target	SeqTools (general stats) — frac reads off target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs Off Target	SeqTools (general stats) — frac pairs off target	`frac_pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads On Target	SeqTools (general stats) — reads on target	`reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs On Target	SeqTools (general stats) — pairs on target	`pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads Off Target	SeqTools (general stats) — reads off target	`reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs Off Target	SeqTools (general stats) — pairs off target	`pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Mean Depth	SeqTools (general stats) — mean depth	`mean_depth`	None
\|\|	Custom content: SeqTools (general stats)	Q50 Depth	SeqTools (general stats) — q50 depth	`q50_depth`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt30X	SeqTools (general stats) — frac bases gt30x	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt100X	SeqTools (general stats) — frac bases gt100x	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools (general stats)	N Q30	SeqTools (general stats) — n q30	`n_q30`	None
\|\|	Custom content: SeqTools (general stats)	GC Bias	SeqTools (general stats) — Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: InsertSizeMetrics	Insert Size	Median Insert Size, all read orientations (bp)	`summed_median`	None
\|\|	Picard: InsertSizeMetrics	Mean Insert Size	Mean Insert Size, all read orientations (bp)	`summed_mean`	None
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	Picard: RnaSeqMetrics	rRNA	Percent of aligned bases overlapping ribosomal RNA regions	`PCT_RIBOSOMAL_BASES`	None
\|\|	Picard: RnaSeqMetrics	mRNA	Percent of aligned bases overlapping UTRs and coding regions of mRNA transcripts	`PCT_MRNA_BASES`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Insert Size

Plot shows the number of reads at a given insert size. Reads with different orientations are summed.

Created with MultiQC

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

RnaSeqMetrics Assignment

Number of bases in primary alignments that align to regions in the reference genome.

Created with MultiQC

Gene Coverage

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁹⁶/₉₆ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
659_6i-T1-TRNA-1_B23WHTKLT4_1	213.8M	0.0M	0.0M	15.8M	1.2M	190.5M	95.3M	95.2M	95.3M	95.3M	108.9M	81.6M	189.8M	0.0M
659_Dl-T1-TRNA-1_B23WHTKLT4_1	219.4M	0.0M	0.0M	22.1M	1.4M	187.3M	93.7M	93.6M	93.7M	93.6M	106.8M	80.5M	186.7M	0.0M
659_Lx-T1-TRNA-1_B23WHTKLT4_1	210.2M	0.0M	0.0M	12.6M	0.8M	191.4M	95.7M	95.7M	95.7M	95.7M	103.2M	88.3M	190.6M	0.0M
659_Mt-T1-TRNA-1_B23WHTKLT4_1	216.6M	0.0M	0.0M	19.6M	1.1M	188.0M	94.1M	93.9M	94.0M	94.0M	104.1M	83.9M	187.4M	0.0M
659_bCu-T1-TRNA-1_B23WHTKLT4_1	148.9M	0.0M	0.0M	13.4M	1.0M	129.5M	64.8M	64.7M	64.7M	64.7M	80.6M	48.9M	129.0M	0.0M
659_bGW-T1-TRNA-1_B23WHTKLT4_1	213.3M	0.0M	0.0M	15.4M	1.0M	190.5M	95.3M	95.2M	95.3M	95.2M	94.5M	96.0M	189.8M	0.0M
659_bGc-T1-TRNA-1_B23WHTKLT4_1	210.2M	0.0M	0.0M	13.0M	1.1M	190.6M	95.3M	95.3M	95.3M	95.3M	103.2M	87.4M	189.9M	0.0M
659_bNS-T1-TRNA-1_B23WHTKLT4_1	210.5M	0.0M	0.0M	12.6M	1.0M	191.3M	95.7M	95.6M	95.7M	95.6M	92.6M	98.7M	190.7M	0.0M
659_bQZ-T1-TRNA-1_B23WHTKLT4_1	213.4M	0.0M	0.0M	15.8M	1.3M	189.5M	94.8M	94.7M	94.8M	94.8M	98.0M	91.6M	188.9M	0.0M
659_bTo-T1-TRNA-1_B23WHTKLT4_1	207.8M	0.0M	0.0M	9.6M	0.8M	192.9M	96.5M	96.4M	96.5M	96.5M	87.8M	105.2M	192.3M	0.0M
659_bUW-T1-TRNA-1_B23WHTKLT4_1	217.2M	0.0M	0.0M	19.1M	0.9M	187.6M	93.8M	93.8M	93.8M	93.8M	87.2M	100.4M	187.1M	0.0M
659_bhK-T1-TRNA-1_B23WHTKLT4_1	207.5M	0.0M	0.0M	9.6M	1.0M	192.5M	96.3M	96.2M	96.3M	96.2M	89.9M	102.6M	191.9M	0.0M
659_buD-T1-TRNA-1_B23WHTKLT4_1	210.7M	0.0M	0.0M	13.2M	1.1M	190.7M	95.4M	95.3M	95.3M	95.3M	96.6M	94.1M	189.9M	0.0M
659_bua-T1-TRNA-1_B23WHTKLT4_1	209.1M	0.0M	0.0M	11.0M	0.9M	192.4M	96.3M	96.2M	96.2M	96.2M	96.0M	96.5M	191.8M	0.0M
659_c95-T1-TRNA-1_B23WHTKLT4_1	213.0M	0.0M	0.0M	15.1M	1.0M	190.8M	95.5M	95.4M	95.4M	95.4M	93.5M	97.3M	190.2M	0.0M
659_cAd-T1-TRNA-1_B23WHTKLT4_1	212.2M	0.0M	0.0M	14.7M	1.2M	190.2M	95.1M	95.0M	95.1M	95.1M	102.5M	87.7M	189.5M	0.0M
659_cIX-T1-TRNA-1_B23WHTKLT4_1	209.1M	0.0M	0.0M	11.2M	0.9M	192.4M	96.3M	96.2M	96.2M	96.2M	97.4M	95.0M	191.8M	0.0M
659_cRB-T1-TRNA-1_B23WHTKLT4_1	212.4M	0.0M	0.0M	14.3M	1.1M	191.3M	95.7M	95.6M	95.7M	95.6M	100.3M	91.0M	190.5M	0.0M
659_cRa-T1-TRNA-1_B23WHTKLT4_1	208.7M	0.0M	0.0M	10.8M	1.0M	192.1M	96.1M	96.0M	96.1M	96.0M	85.0M	107.1M	191.5M	0.0M
659_cTi-T1-TRNA-1_B23WHTKLT4_1	209.6M	0.0M	0.0M	12.1M	1.1M	190.8M	95.5M	95.4M	95.4M	95.4M	93.6M	97.3M	190.1M	0.0M
659_cVw-T1-TRNA-1_B23WHTKLT4_1	212.8M	0.0M	0.0M	15.1M	1.1M	189.8M	94.9M	94.9M	94.9M	94.9M	95.5M	94.3M	189.3M	0.0M
659_cWx-T1-TRNA-1_B23WHTKLT4_1	214.3M	0.0M	0.0M	17.7M	1.1M	188.4M	94.2M	94.1M	94.2M	94.2M	101.9M	86.5M	187.7M	0.0M
659_cfy-T1-TRNA-1_B23WHTKLT4_1	208.7M	0.0M	0.0M	10.8M	0.8M	192.3M	96.2M	96.1M	96.2M	96.1M	92.7M	99.6M	191.6M	0.0M
659_ciJ-T1-TRNA-1_B23WHTKLT4_1	210.4M	0.0M	0.0M	12.6M	1.1M	191.0M	95.5M	95.5M	95.5M	95.5M	98.6M	92.4M	190.4M	0.0M
659_ciZ-T1-TRNA-1_B23WHTKLT4_1	213.7M	0.0M	0.0M	15.7M	1.0M	190.2M	95.1M	95.0M	95.1M	95.1M	103.3M	86.8M	189.4M	0.0M
659_d01-T1-TRNA-1_B23WHTKLT4_1	211.6M	0.0M	0.0M	14.6M	1.1M	189.7M	94.9M	94.8M	94.8M	94.8M	109.9M	79.8M	189.1M	0.0M
659_dES-T1-TRNA-1_B23WHTKLT4_1	213.6M	0.0M	0.0M	15.3M	1.0M	190.8M	95.4M	95.3M	95.4M	95.4M	98.2M	92.6M	190.1M	0.0M
659_dc8-T1-TRNA-1_B23WHTKLT4_1	211.3M	0.0M	0.0M	14.2M	1.0M	189.8M	94.9M	94.9M	94.9M	94.9M	96.7M	93.1M	189.1M	0.0M
659_dcz-T1-TRNA-1_B23WHTKLT4_1	107.1M	0.0M	0.0M	10.8M	0.7M	91.5M	45.8M	45.7M	45.8M	45.7M	58.7M	32.8M	91.1M	0.0M
659_djb-T1-TRNA-1_B23WHTKLT4_1	211.9M	0.0M	0.0M	13.6M	1.0M	191.6M	95.8M	95.8M	95.8M	95.8M	95.4M	96.2M	190.9M	0.0M
659_dm4-T1-TRNA-1_B23WHTKLT4_1	218.5M	0.0M	0.0M	21.4M	1.3M	187.5M	93.8M	93.7M	93.8M	93.7M	119.5M	68.0M	186.8M	0.0M
659_dts-T1-TRNA-1_B23WHTKLT4_1	212.4M	0.0M	0.0M	15.0M	1.1M	189.9M	95.0M	94.9M	94.9M	94.9M	102.4M	87.4M	189.1M	0.0M
659_ecd-T1-TRNA-1_B23WHTKLT4_1	210.3M	0.0M	0.0M	12.1M	0.8M	192.0M	96.1M	96.0M	96.0M	96.0M	92.8M	99.2M	191.4M	0.0M
659_epP-T1-TRNA-1_B23WHTKLT4_1	216.3M	0.0M	0.0M	18.6M	1.1M	188.8M	94.4M	94.3M	94.4M	94.4M	100.7M	88.1M	188.1M	0.0M
659_ezg-T1-TRNA-1_B23WHTKLT4_1	212.8M	0.0M	0.0M	14.7M	1.0M	191.1M	95.6M	95.5M	95.5M	95.5M	94.9M	96.1M	190.4M	0.0M
659_gK-T1-TRNA-1_B23WHTKLT4_1	213.0M	0.0M	0.0M	15.8M	0.9M	188.8M	94.4M	94.3M	94.4M	94.4M	96.6M	92.2M	188.2M	0.0M
659_rd-T1-TRNA-1_B23WHTKLT4_1	208.2M	0.0M	0.0M	10.1M	0.9M	192.9M	96.5M	96.4M	96.5M	96.4M	93.9M	99.0M	192.1M	0.0M
FFPE_HD789_01_RNA_13_B23WHTKLT4_1	209.7M	0.0M	0.0M	11.6M	0.9M	192.0M	96.0M	95.9M	96.0M	96.0M	86.4M	105.5M	191.5M	0.0M
FFPE_V4_0002_RNA_0001_B23WHTKLT4_1	212.4M	0.0M	0.0M	14.4M	1.2M	190.7M	95.4M	95.3M	95.3M	95.3M	94.0M	96.7M	190.1M	0.0M
NTC_0001_0001_B23WHTKLT4_1	0.2M	0.0M	0.0M	0.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
tih_rna_sample_00087_B23WHTKLT4_1	212.6M	0.0M	0.0M	14.4M	1.0M	191.0M	95.5M	95.4M	95.5M	95.5M	95.7M	95.3M	190.4M	0.0M
tih_rna_sample_00087_B23WHTKLT4_2	213.0M	0.0M	0.0M	14.9M	1.0M	190.5M	95.3M	95.2M	95.3M	95.3M	97.9M	92.7M	189.9M	0.0M
tih_rna_sample_00089_B23WHTKLT4_1	213.4M	0.0M	0.0M	15.3M	0.8M	191.1M	95.6M	95.5M	95.6M	95.6M	94.3M	96.8M	190.5M	0.0M
tih_rna_sample_00089_B23WHTKLT4_2	213.4M	0.0M	0.0M	15.4M	0.9M	191.0M	95.5M	95.4M	95.5M	95.5M	94.3M	96.7M	190.4M	0.0M
tih_rna_sample_00090_B23WHTKLT4_1	222.0M	0.0M	0.0M	24.5M	1.3M	186.9M	93.5M	93.4M	93.5M	93.5M	107.5M	79.4M	186.2M	0.0M
tih_rna_sample_00090_B23WHTKLT4_2	220.3M	0.0M	0.0M	23.0M	1.3M	186.9M	93.5M	93.4M	93.5M	93.5M	105.1M	81.8M	186.2M	0.0M
tih_rna_sample_00096_B23WHTKLT4_1	210.6M	0.0M	0.0M	12.6M	0.9M	191.7M	95.9M	95.8M	95.8M	95.8M	99.7M	92.0M	191.1M	0.0M
tih_rna_sample_00096_B23WHTKLT4_2	210.5M	0.0M	0.0M	12.5M	1.0M	191.6M	95.8M	95.7M	95.8M	95.8M	100.1M	91.5M	191.0M	0.0M
tih_rna_sample_00097_B23WHTKLT4_1	213.7M	0.0M	0.0M	15.4M	0.9M	190.9M	95.5M	95.4M	95.5M	95.4M	92.6M	98.2M	190.2M	0.0M
tih_rna_sample_00097_B23WHTKLT4_2	213.7M	0.0M	0.0M	15.9M	0.9M	190.1M	95.1M	95.0M	95.1M	95.0M	94.2M	95.9M	189.4M	0.0M
tih_rna_sample_00116_B23WHTKLT4_1	212.2M	0.0M	0.0M	14.0M	1.1M	191.3M	95.7M	95.6M	95.6M	95.6M	102.3M	89.0M	190.5M	0.0M
tih_rna_sample_00116_B23WHTKLT4_2	211.7M	0.0M	0.0M	14.0M	1.1M	190.6M	95.3M	95.3M	95.3M	95.3M	102.9M	87.7M	189.8M	0.0M
tih_rna_sample_00121_B23WHTKLT4_1	210.9M	0.0M	0.0M	12.8M	1.0M	191.5M	95.8M	95.7M	95.8M	95.7M	101.5M	90.0M	190.8M	0.0M
tih_rna_sample_00121_B23WHTKLT4_2	210.9M	0.0M	0.0M	12.6M	1.0M	191.8M	95.9M	95.8M	95.9M	95.9M	100.2M	91.6M	191.1M	0.0M
tih_rna_sample_00124_B23WHTKLT4_1	210.0M	0.0M	0.0M	11.9M	1.1M	191.6M	95.8M	95.8M	95.8M	95.8M	97.4M	94.2M	190.9M	0.0M
tih_rna_sample_00124_B23WHTKLT4_2	209.7M	0.0M	0.0M	11.4M	1.2M	192.1M	96.1M	96.0M	96.1M	96.0M	95.0M	97.1M	191.4M	0.0M
tih_rna_sample_00136_B23WHTKLT4_1	212.3M	0.0M	0.0M	14.2M	1.0M	190.9M	95.5M	95.4M	95.5M	95.4M	103.4M	87.6M	190.3M	0.0M
tih_rna_sample_00136_B23WHTKLT4_2	212.7M	0.0M	0.0M	14.7M	1.0M	190.6M	95.4M	95.3M	95.3M	95.3M	104.9M	85.8M	190.0M	0.0M
tih_rna_sample_00145_B23WHTKLT4_1	212.9M	0.0M	0.0M	14.7M	1.1M	190.9M	95.5M	95.4M	95.5M	95.4M	95.5M	95.4M	190.1M	0.0M
tih_rna_sample_00145_B23WHTKLT4_2	214.0M	0.0M	0.0M	15.9M	1.1M	190.3M	95.2M	95.1M	95.2M	95.1M	100.8M	89.5M	189.5M	0.0M
tih_rna_sample_00146_B23WHTKLT4_1	209.1M	0.0M	0.0M	11.0M	1.0M	192.2M	96.1M	96.0M	96.1M	96.1M	93.5M	98.7M	191.5M	0.0M
tih_rna_sample_00146_B23WHTKLT4_2	209.4M	0.0M	0.0M	11.3M	1.0M	192.2M	96.1M	96.0M	96.1M	96.1M	95.3M	96.9M	191.6M	0.0M
tih_rna_sample_00149_B23WHTKLT4_1	211.4M	0.0M	0.0M	13.3M	0.9M	191.4M	95.8M	95.7M	95.7M	95.7M	103.3M	88.1M	190.7M	0.0M
tih_rna_sample_00149_B23WHTKLT4_2	211.8M	0.0M	0.0M	13.5M	0.9M	191.7M	95.9M	95.8M	95.8M	95.8M	103.0M	88.7M	190.9M	0.0M
tih_rna_sample_00150_B23WHTKLT4_1	209.1M	0.0M	0.0M	11.3M	0.9M	192.0M	96.0M	95.9M	96.0M	96.0M	95.0M	97.0M	191.3M	0.0M
tih_rna_sample_00150_B23WHTKLT4_2	209.7M	0.0M	0.0M	11.6M	0.9M	192.3M	96.2M	96.1M	96.2M	96.1M	94.6M	97.7M	191.6M	0.0M
tih_rna_sample_00158_B23WHTKLT4_1	215.3M	0.0M	0.0M	17.6M	1.1M	189.0M	94.6M	94.5M	94.5M	94.5M	99.5M	89.5M	188.5M	0.0M
tih_rna_sample_00158_B23WHTKLT4_2	215.1M	0.0M	0.0M	18.1M	1.1M	188.0M	94.0M	94.0M	94.0M	94.0M	100.8M	87.2M	187.4M	0.0M
tih_rna_sample_00161_B23WHTKLT4_1	213.2M	0.0M	0.0M	15.1M	0.9M	191.3M	95.7M	95.6M	95.7M	95.6M	100.2M	91.1M	190.6M	0.0M
tih_rna_sample_00161_B23WHTKLT4_2	213.1M	0.0M	0.0M	15.1M	0.9M	191.3M	95.7M	95.6M	95.7M	95.6M	98.4M	92.9M	190.6M	0.0M
tih_rna_sample_00163_B23WHTKLT4_1	210.9M	0.0M	0.0M	12.9M	0.9M	191.6M	95.8M	95.7M	95.8M	95.8M	95.8M	95.7M	191.0M	0.0M
tih_rna_sample_00163_B23WHTKLT4_2	210.7M	0.0M	0.0M	13.2M	0.9M	190.8M	95.5M	95.4M	95.4M	95.4M	97.3M	93.5M	190.2M	0.0M
tih_rna_sample_00164_B23WHTKLT4_1	215.2M	0.0M	0.0M	17.5M	1.4M	189.7M	94.9M	94.8M	94.9M	94.8M	101.9M	87.9M	189.0M	0.0M
tih_rna_sample_00164_B23WHTKLT4_2	220.2M	0.0M	0.0M	22.3M	1.6M	189.0M	94.5M	94.5M	94.5M	94.5M	103.3M	85.7M	188.2M	0.0M
tih_rna_sample_00166_B23WHTKLT4_1	210.1M	0.0M	0.0M	12.4M	0.9M	191.1M	95.6M	95.5M	95.6M	95.5M	96.3M	94.7M	190.4M	0.0M
tih_rna_sample_00166_B23WHTKLT4_2	211.0M	0.0M	0.0M	12.7M	0.9M	191.6M	95.9M	95.8M	95.8M	95.8M	98.0M	93.6M	191.0M	0.0M
tih_rna_sample_00434_B23WHTKLT4_1	211.9M	0.0M	0.0M	14.0M	0.9M	190.6M	95.4M	95.3M	95.3M	95.3M	102.6M	88.1M	190.0M	0.0M
tih_rna_sample_00434_B23WHTKLT4_2	211.5M	0.0M	0.0M	13.4M	0.9M	191.0M	95.6M	95.5M	95.5M	95.5M	99.5M	91.5M	190.3M	0.0M
tih_rna_sample_00451_B23WHTKLT4_1	212.8M	0.0M	0.0M	14.5M	1.1M	191.0M	95.5M	95.4M	95.5M	95.5M	102.7M	88.3M	190.2M	0.0M
tih_rna_sample_00451_B23WHTKLT4_2	213.4M	0.0M	0.0M	15.0M	1.1M	190.8M	95.4M	95.3M	95.4M	95.4M	103.7M	87.0M	190.0M	0.0M
tih_rna_sample_00457_B23WHTKLT4_1	209.5M	0.0M	0.0M	11.6M	1.0M	191.9M	96.0M	95.9M	96.0M	95.9M	94.7M	97.2M	191.2M	0.0M
tih_rna_sample_00457_B23WHTKLT4_2	210.3M	0.0M	0.0M	12.1M	1.0M	192.0M	96.0M	96.0M	96.0M	96.0M	95.2M	96.8M	191.3M	0.0M
tih_rna_sample_00461_B23WHTKLT4_1	109.1M	0.0M	0.0M	7.5M	0.4M	98.0M	49.0M	49.0M	49.0M	49.0M	48.8M	49.2M	97.7M	0.0M
tih_rna_sample_00461_B23WHTKLT4_2	212.6M	0.0M	0.0M	15.3M	0.9M	190.0M	95.0M	94.9M	95.0M	95.0M	97.1M	92.9M	189.4M	0.0M
tih_rna_sample_00462_B23WHTKLT4_1	207.7M	0.0M	0.0M	9.8M	0.9M	192.5M	96.3M	96.2M	96.3M	96.3M	92.6M	99.9M	191.9M	0.0M
tih_rna_sample_00462_B23WHTKLT4_2	207.9M	0.0M	0.0M	9.7M	0.9M	192.9M	96.5M	96.4M	96.5M	96.4M	91.2M	101.7M	192.2M	0.0M
tih_rna_sample_00464_B23WHTKLT4_1	211.3M	0.0M	0.0M	13.3M	1.1M	191.1M	95.6M	95.5M	95.6M	95.6M	99.2M	91.9M	190.4M	0.0M
tih_rna_sample_00464_B23WHTKLT4_2	211.8M	0.0M	0.0M	14.3M	1.1M	190.1M	95.1M	95.0M	95.1M	95.0M	102.4M	87.7M	189.4M	0.0M
tih_rna_sample_00467_B23WHTKLT4_1	220.1M	0.0M	0.0M	22.2M	1.3M	188.1M	94.1M	94.0M	94.1M	94.1M	108.5M	79.6M	187.5M	0.0M
tih_rna_sample_00467_B23WHTKLT4_2	221.6M	0.0M	0.0M	23.9M	1.3M	187.5M	93.8M	93.7M	93.8M	93.7M	112.1M	75.3M	186.8M	0.0M
tih_rna_sample_00473_B23WHTKLT4_1	210.2M	0.0M	0.0M	12.5M	0.9M	191.2M	95.7M	95.6M	95.6M	95.6M	92.9M	98.3M	190.6M	0.0M
tih_rna_sample_00473_B23WHTKLT4_2	209.9M	0.0M	0.0M	12.0M	0.9M	191.7M	95.9M	95.8M	95.9M	95.8M	91.4M	100.3M	191.1M	0.0M
tih_rna_sample_00479_B23WHTKLT4_1	210.8M	0.0M	0.0M	12.7M	0.8M	191.7M	95.9M	95.8M	95.8M	95.8M	88.8M	102.9M	191.0M	0.0M
tih_rna_sample_00479_B23WHTKLT4_2	211.4M	0.0M	0.0M	13.5M	0.8M	191.2M	95.6M	95.5M	95.6M	95.6M	90.8M	100.3M	190.5M	0.0M
tih_rna_sample_00480_B23WHTKLT4_1	213.1M	0.0M	0.0M	15.5M	1.0M	190.6M	95.3M	95.2M	95.3M	95.3M	100.0M	90.6M	190.0M	0.0M
tih_rna_sample_00480_B23WHTKLT4_2	213.0M	0.0M	0.0M	15.3M	1.0M	190.6M	95.3M	95.2M	95.3M	95.3M	100.0M	90.6M	190.0M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	192	156972475	0.2057%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	4	7901	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	4	6274	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	3	2337	0.0000%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	2	3636	0.0000%
GACATGAAGGTGCAGAGGGAGACAGATGAGGTGAAATAGAAGGTCATGCT	2	74	0.0000%
AAAGTAATAGCTACTATTTTTTCTCTTTCAGTTGCAGGAGAAATAACAAG	2	72	0.0000%
ATGGGAATCCATTGGCGCTTCGGACAAGTCCTTCCCCTGCTCCGCCTTGA	2	70	0.0000%
CATTGTGGTAATTGGCATGCTGGCCACGGGCCTCAGTCCCACCACCCGTA	2	75	0.0000%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTACGAACTATCTAGT	1	398955	0.0005%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCACTTCGTATCTAGT	1	434206	0.0006%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACAATAGGTAGGATCTGGG	1	212407	0.0003%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTATCCGATATCTAGT	1	354756	0.0005%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGAACACGAATCTGGG	1	346414	0.0005%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCAGACCGATATCTAGT	1	359046	0.0005%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGCAGC	1	765	0.0000%
GATCGGAGAGCACACGTCTGAACTCCAGTCACAATCTGCAGTATCTAGTA	1	289	0.0000%
GATCGGAAGAGCACACGTCTGAACTCAGTCACAATCTGCAGTATCTAGTA	1	244	0.0000%
GATCGGAAAGAGCACACGTCTGAACTCCAGTCACAATCTGCAGTATCTAG	1	234	0.0000%
GCTGCCGGGGGGGCTGTAACACTCGGCAGCA	1	172	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	96	30744623	0.1666%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	2	3918	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	2	3134	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	2	1439	0.0000%
GACATGAAGGTGCAGAGGGAGACAGATGAGGTGAAATAGAAGGTCATGCT	2	74	0.0000%
AAAGTAATAGCTACTATTTTTTCTCTTTCAGTTGCAGGAGAAATAACAAG	2	72	0.0000%
ATGGGAATCCATTGGCGCTTCGGACAAGTCCTTCCCCTGCTCCGCCTTGA	2	70	0.0000%
CATTGTGGTAATTGGCATGCTGGCCACGGGCCTCAGTCCCACCACCCGTA	2	75	0.0000%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	1	1815	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGCAGC	1	765	0.0000%
GATCGGAGAGCACACGTCTGAACTCCAGTCACAATCTGCAGTATCTAGTA	1	289	0.0000%
GATCGGAAGAGCACACGTCTGAACTCAGTCACAATCTGCAGTATCTAGTA	1	244	0.0000%
GATCGGAAAGAGCACACGTCTGAACTCCAGTCACAATCTGCAGTATCTAG	1	234	0.0000%
GCTGCCGGGGGGGCTGTAACACTCGGCAGCA	1	172	0.0000%
GATCGGAAGAGCACACGTCTGACTCCAGTCACAATCTGCAGTATCTAGTA	1	145	0.0000%
GATCGGAAGAGCACACGTCTGAACTCCGTCACAATCTGCAGTATCTAGTA	1	132	0.0000%
GATCGGAGAGCACACGTCTGAACTCCAGTCACAATCTGCAGTATCTAGTG	1	129	0.0000%
GATCGGAAGAGCACACGTCTGAACTCCCAGTCACAATCTGCAGTATCTAG	1	101	0.0000%
GATCGGAAGAGCACACGTCTGAACTCCATCACAATCTGCAGTATCTAGTA	1	90	0.0000%
GATCGGAAGAGCACACGTCTGAACTCAGTCACAATCTGCAGTATCTAGTG	1	86	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER	filter_arriba_main.py	`1.0`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CONTAMINATION_SKIPPED_LOW_READS	contamination_skipped_low_reads	`1.0.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PICARD_COLLECTINSERTSIZEMETRICS	picard	`3.1.0`
PICARD_COLLECTRNASEQMETRICS	picard	`null`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
SAMTOOLS_INDEX_ALIGNMENT_CRAM	samtools	`1.17`
SAMTOOLS_INDEX_STAR_ALIGNMENT	samtools	`1.17`
SAMTOOLS_VIEW_ALIGNMENT_CRAM	samtools	`1.17`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	boto3	`unknown`
	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_ALIGNMENT	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.0`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`3.0.2`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run /code/main.nf -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0020/B23WHTKLT4/nfcore_rnafusion_100M__04da504a--20260527-151807' --project-dir /Users/anaik/Documents/Altera/rnafusion -profile docker,eks,std_run -name dev_rna_exp0020_100M-04da504a --rundir 's3://natera-labdata-rnd-dev-s3/illumina/20260515_LH00995_0042_B23WHTKLT4/' --bclconvert_samplesheet 's3://natera-labdata-rnd-dev-s3/illumina/20260515_LH00995_0042_B23WHTKLT4/bclconvert_samplesheet.csv' --flowcell_id 20260515_LH00995_0042_B23WHTKLT4 --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0020/B23WHTKLT4/nfcore_rnafusion_100M__04da504a--20260527-151807' --fastp_reads_to_process 100000000

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp0020_100M-04da504a
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /code
userName: nextflow
profile: docker,eks,std_run
configFiles: N/A

Input/output options

outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0020/B23WHTKLT4/nfcore_rnafusion_100M__04da504a--20260527-151807
rundir: s3://natera-labdata-rnd-dev-s3/illumina/20260515_LH00995_0042_B23WHTKLT4/
flowcell_id: 20260515_LH00995_0042_B23WHTKLT4
strand: reverse
bclconvert_samplesheet: s3://natera-labdata-rnd-dev-s3/illumina/20260515_LH00995_0042_B23WHTKLT4/bclconvert_samplesheet.csv
infer_sample_type_map: true
sample_type_map_positive_substring: HD789
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
arriba_gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir//ref_annot.gtf
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
starindex_ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
fastp_reads_to_process: 100000000
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Insert Size

Mark Duplicates Help

RnaSeqMetrics Assignment

Gene Coverage

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks