Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 91113
total bases: 13758063
Q20 bases: 11829503(85.9823%)
Q30 bases: 8751974(63.6134%)

Read2 before filtering:
total reads: 91113
total bases: 13758063
Q20 bases: 13103002(95.2387%)
Q30 bases: 10520260(76.4661%)

Read1 after filtering:
total reads: 3897
total bases: 388128
Q20 bases: 358619(92.3971%)
Q30 bases: 310163(79.9126%)

Read2 after filtering:
total reads: 3897
total bases: 391910
Q20 bases: 376209(95.9937%)
Q30 bases: 339939(86.739%)

Filtering result:
reads passed filter: 7794
reads failed due to low quality: 3316
reads failed due to too many N: 0
reads failed due to too short: 171116
reads with adapter trimmed: 93744
bases trimmed due to adapters: 3516535

Duplication rate: 47.3269%

Insert size peak (evaluated by paired-end reads): 87

JSON report: NTC_0001_0001_A23YTGFLT4_1.fastp.json
HTML report: NTC_0001_0001_A23YTGFLT4_1.fastp.html

fastp --in1 NTC_0001_0001_A23YTGFLT4_1_1.fastq.gz --in2 NTC_0001_0001_A23YTGFLT4_1_2.fastq.gz --out1 NTC_0001_0001_A23YTGFLT4_1_1.fastp.fastq.gz --out2 NTC_0001_0001_A23YTGFLT4_1_2.fastp.fastq.gz --json NTC_0001_0001_A23YTGFLT4_1.fastp.json --html NTC_0001_0001_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 3 seconds