File Info

Filename
aih-tih-sc-598a93-R1_A23YTGFLT4_1.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0021/A23YTGFLT4/nfcore_rnafusion__73d51683--20260607-225254/fastp/aih-tih-sc-598a93-R1_A23YTGFLT4_1.fastp.log
Size
1.6 KB
Published
Jun 08, 2026 12:24 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 61714805
total bases: 9318935555
Q20 bases: 9010588461(96.6912%)
Q30 bases: 8561391144(91.8709%)

Read2 before filtering:
total reads: 61714805
total bases: 9318935555
Q20 bases: 9099122890(97.6412%)
Q30 bases: 8636650527(92.6785%)

Read1 after filtering:
total reads: 60743285
total bases: 6674791650
Q20 bases: 6644490796(99.546%)
Q30 bases: 6507614497(97.4954%)

Read2 after filtering:
total reads: 60743285
total bases: 6686971859
Q20 bases: 6639487229(99.2899%)
Q30 bases: 6474518184(96.8229%)

Filtering result:
reads passed filter: 121486570
reads failed due to low quality: 1428564
reads failed due to too many N: 3890
reads failed due to too short: 510586
reads with adapter trimmed: 101483537
bases trimmed due to adapters: 5028060681

Duplication rate: 42.0221%

Insert size peak (evaluated by paired-end reads): 97

JSON report: aih-tih-sc-598a93-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-598a93-R1_A23YTGFLT4_1.fastp.html

fastp --in1 aih-tih-sc-598a93-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-598a93-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-598a93-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-598a93-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-598a93-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-598a93-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 154 seconds