Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 53899860
total bases: 8138878860
Q20 bases: 7770936978(95.4792%)
Q30 bases: 7220016103(88.7102%)

Read2 before filtering:
total reads: 53899860
total bases: 8138878860
Q20 bases: 7912020166(97.2127%)
Q30 bases: 7436574713(91.371%)

Read1 after filtering:
total reads: 52859459
total bases: 5256643244
Q20 bases: 5228442407(99.4635%)
Q30 bases: 5108751061(97.1866%)

Read2 after filtering:
total reads: 52859459
total bases: 5268926181
Q20 bases: 5234564842(99.3478%)
Q30 bases: 5112608609(97.0332%)

Filtering result:
reads passed filter: 105718918
reads failed due to low quality: 1246834
reads failed due to too many N: 2844
reads failed due to too short: 831124
reads with adapter trimmed: 97990547
bases trimmed due to adapters: 5491336765

Duplication rate: 36.0829%

Insert size peak (evaluated by paired-end reads): 88

JSON report: aih-tih-sc-fba77b-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-fba77b-R1_A23YTGFLT4_1.fastp.html

fastp --in1 aih-tih-sc-fba77b-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-fba77b-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-fba77b-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-fba77b-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-fba77b-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-fba77b-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 146 seconds