Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 188899914
total bases: 28523887014
Q20 bases: 27443996583(96.2141%)
Q30 bases: 25983643200(91.0943%)

Read2 before filtering:
total reads: 188899914
total bases: 28523887014
Q20 bases: 27863380148(97.6844%)
Q30 bases: 26454493094(92.745%)

Read1 after filtering:
total reads: 186477714
total bases: 20125750929
Q20 bases: 20040540323(99.5766%)
Q30 bases: 19648895574(97.6306%)

Read2 after filtering:
total reads: 186477714
total bases: 20156488569
Q20 bases: 20034176118(99.3932%)
Q30 bases: 19579809413(97.139%)

Filtering result:
reads passed filter: 372955428
reads failed due to low quality: 4480748
reads failed due to too many N: 11566
reads failed due to too short: 352086
reads with adapter trimmed: 313413830
bases trimmed due to adapters: 16156309708

Duplication rate: 29.5101%

Insert size peak (evaluated by paired-end reads): 96

JSON report: aih-tih-sc-7fa0fb-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-7fa0fb-R1_A23YTGFLT4_1.fastp.html

fastp --in1 aih-tih-sc-7fa0fb-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-7fa0fb-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-7fa0fb-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-7fa0fb-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-7fa0fb-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-7fa0fb-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 443 seconds