Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44531892457(98.3044%)
Q30 bases: 43161575208(95.2794%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44518873368(98.2757%)
Q30 bases: 42806557865(94.4957%)

Read1 after filtering:
total reads: 296584083
total bases: 38414786338
Q20 bases: 38263404436(99.6059%)
Q30 bases: 37539293859(97.7209%)

Read2 after filtering:
total reads: 296584083
total bases: 38442674188
Q20 bases: 38190462193(99.3439%)
Q30 bases: 37264009793(96.934%)

Filtering result:
reads passed filter: 593168166
reads failed due to low quality: 6628820
reads failed due to too many N: 24324
reads failed due to too short: 178690
reads with adapter trimmed: 317687614
bases trimmed due to adapters: 12802022514

Duplication rate: 29.5171%

Insert size peak (evaluated by paired-end reads): 118

JSON report: aih-tih-sc-377071-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-377071-R1_A23YTGFLT4_1.fastp.html

fastp --in1 aih-tih-sc-377071-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-377071-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-377071-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-377071-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-377071-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-377071-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 975 seconds