Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 268831957
total bases: 40593625507
Q20 bases: 39724759601(97.8596%)
Q30 bases: 38211723328(94.1323%)

Read2 before filtering:
total reads: 268831957
total bases: 40593625507
Q20 bases: 39816139669(98.0847%)
Q30 bases: 38132464361(93.9371%)

Read1 after filtering:
total reads: 265637886
total bases: 31712770883
Q20 bases: 31575365818(99.5667%)
Q30 bases: 30949557397(97.5934%)

Read2 after filtering:
total reads: 265637886
total bases: 31752942507
Q20 bases: 31546079836(99.3485%)
Q30 bases: 30801463250(97.0035%)

Filtering result:
reads passed filter: 531275772
reads failed due to low quality: 6134008
reads failed due to too many N: 18524
reads failed due to too short: 235610
reads with adapter trimmed: 379800127
bases trimmed due to adapters: 16882103061

Duplication rate: 33.8403%

Insert size peak (evaluated by paired-end reads): 109

JSON report: aih-tih-sc-49909d-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-49909d-R1_A23YTGFLT4_1.fastp.html

fastp --in1 aih-tih-sc-49909d-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-49909d-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-49909d-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-49909d-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-49909d-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-49909d-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 680 seconds