Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44216393040(97.6079%)
Q30 bases: 42563814405(93.9599%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44425541353(98.0696%)
Q30 bases: 42515171204(93.8525%)

Read1 after filtering:
total reads: 296500420
total bases: 35690210313
Q20 bases: 35536773753(99.5701%)
Q30 bases: 34824951872(97.5756%)

Read2 after filtering:
total reads: 296500420
total bases: 35726702735
Q20 bases: 35490498812(99.3389%)
Q30 bases: 34628978282(96.9274%)

Filtering result:
reads passed filter: 593000840
reads failed due to low quality: 6783814
reads failed due to too many N: 23334
reads failed due to too short: 192012
reads with adapter trimmed: 420740625
bases trimmed due to adapters: 18257143761

Duplication rate: 36.699%

Insert size peak (evaluated by paired-end reads): 107

JSON report: aih-tih-sc-cece97-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-cece97-R1_A23YTGFLT4_1.fastp.html

fastp --in1 aih-tih-sc-cece97-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-cece97-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-cece97-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-cece97-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-cece97-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-cece97-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 783 seconds