Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44272524396(97.7318%)
Q30 bases: 42618307307(94.0801%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44500470543(98.235%)
Q30 bases: 42685939459(94.2294%)

Read1 after filtering:
total reads: 297220257
total bases: 36053418970
Q20 bases: 35897037028(99.5662%)
Q30 bases: 35171553692(97.554%)

Read2 after filtering:
total reads: 297220257
total bases: 36083245702
Q20 bases: 35868976771(99.4062%)
Q30 bases: 35052422403(97.1432%)

Filtering result:
reads passed filter: 594440514
reads failed due to low quality: 5365304
reads failed due to too many N: 23578
reads failed due to too short: 170604
reads with adapter trimmed: 410261666
bases trimmed due to adapters: 17724944139

Duplication rate: 31.8991%

Insert size peak (evaluated by paired-end reads): 109

JSON report: aih-tih-sc-d1f1a3-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-d1f1a3-R1_A23YTGFLT4_1.fastp.html

fastp --in1 aih-tih-sc-d1f1a3-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-d1f1a3-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-d1f1a3-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-d1f1a3-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-d1f1a3-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-d1f1a3-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 902 seconds