Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 244443028
total bases: 36910897228
Q20 bases: 36003476866(97.5416%)
Q30 bases: 34468871607(93.384%)

Read2 before filtering:
total reads: 244443028
total bases: 36910897228
Q20 bases: 36133192211(97.893%)
Q30 bases: 34459005403(93.3573%)

Read1 after filtering:
total reads: 241243052
total bases: 27606760561
Q20 bases: 27488366773(99.5711%)
Q30 bases: 26943407653(97.5971%)

Read2 after filtering:
total reads: 241243052
total bases: 27644050889
Q20 bases: 27469330007(99.368%)
Q30 bases: 26827007622(97.0444%)

Filtering result:
reads passed filter: 482486104
reads failed due to low quality: 5972896
reads failed due to too many N: 16746
reads failed due to too short: 410310
reads with adapter trimmed: 372268163
bases trimmed due to adapters: 17743619191

Duplication rate: 33.5659%

Insert size peak (evaluated by paired-end reads): 98

JSON report: aih-tih-sc-ecc0bc-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-ecc0bc-R1_A23YTGFLT4_1.fastp.html

fastp --in1 aih-tih-sc-ecc0bc-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-ecc0bc-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-ecc0bc-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-ecc0bc-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-ecc0bc-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-ecc0bc-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 651 seconds