Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44597545758(98.4493%)
Q30 bases: 43242041620(95.457%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44498292464(98.2302%)
Q30 bases: 42767289814(94.409%)

Read1 after filtering:
total reads: 296352227
total bases: 38632445997
Q20 bases: 38472167052(99.5851%)
Q30 bases: 37715848397(97.6274%)

Read2 after filtering:
total reads: 296352227
total bases: 38661163148
Q20 bases: 38391112659(99.3015%)
Q30 bases: 37412877726(96.7712%)

Filtering result:
reads passed filter: 592704454
reads failed due to low quality: 7140698
reads failed due to too many N: 23712
reads failed due to too short: 131136
reads with adapter trimmed: 314161355
bases trimmed due to adapters: 12300443959

Duplication rate: 31.6521%

Insert size peak (evaluated by paired-end reads): 119

JSON report: aih-tih-sc-d963a2-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-d963a2-R1_A23YTGFLT4_1.fastp.html

fastp --in1 aih-tih-sc-d963a2-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-d963a2-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-d963a2-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-d963a2-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-d963a2-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-d963a2-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 915 seconds