Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44380657575(97.9705%)
Q30 bases: 42719256727(94.303%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44326221070(97.8504%)
Q30 bases: 42316771041(93.4145%)

Read1 after filtering:
total reads: 296219478
total bases: 36946022195
Q20 bases: 36764155965(99.5078%)
Q30 bases: 35951666684(97.3086%)

Read2 after filtering:
total reads: 296219478
total bases: 36988021550
Q20 bases: 36706007858(99.2376%)
Q30 bases: 35704438607(96.5297%)

Filtering result:
reads passed filter: 592438956
reads failed due to low quality: 7342632
reads failed due to too many N: 24442
reads failed due to too short: 193970
reads with adapter trimmed: 372331622
bases trimmed due to adapters: 15646540703

Duplication rate: 43.9835%

Insert size peak (evaluated by paired-end reads): 111

JSON report: aih-tih-sc-eecf9f-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-eecf9f-R1_A23YTGFLT4_1.fastp.html

fastp --in1 aih-tih-sc-eecf9f-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-eecf9f-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-eecf9f-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-eecf9f-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-eecf9f-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-eecf9f-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 725 seconds