Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 222044506
total bases: 33528720406
Q20 bases: 32542512817(97.0586%)
Q30 bases: 31067940001(92.6607%)

Read2 before filtering:
total reads: 222044506
total bases: 33528720406
Q20 bases: 32800842008(97.8291%)
Q30 bases: 31200201152(93.0552%)

Read1 after filtering:
total reads: 219597035
total bases: 24415435497
Q20 bases: 24311919137(99.576%)
Q30 bases: 23829736025(97.6011%)

Read2 after filtering:
total reads: 219597035
total bases: 24448724971
Q20 bases: 24301175836(99.3965%)
Q30 bases: 23753392877(97.156%)

Filtering result:
reads passed filter: 439194070
reads failed due to low quality: 4524332
reads failed due to too many N: 14924
reads failed due to too short: 355686
reads with adapter trimmed: 363267512
bases trimmed due to adapters: 17569500894

Duplication rate: 35.0539%

Insert size peak (evaluated by paired-end reads): 97

JSON report: aih-tih-sc-ffd2af-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-ffd2af-R1_A23YTGFLT4_1.fastp.html

fastp --in1 aih-tih-sc-ffd2af-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-ffd2af-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-ffd2af-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-ffd2af-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-ffd2af-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-ffd2af-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 594 seconds