Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 91113 total bases: 13758063 Q20 bases: 11829503(85.9823%) Q30 bases: 8751974(63.6134%) Read2 before filtering: total reads: 91113 total bases: 13758063 Q20 bases: 13103002(95.2387%) Q30 bases: 10520260(76.4661%) Read1 after filtering: total reads: 3897 total bases: 388128 Q20 bases: 358619(92.3971%) Q30 bases: 310163(79.9126%) Read2 after filtering: total reads: 3897 total bases: 391910 Q20 bases: 376209(95.9937%) Q30 bases: 339939(86.739%) Filtering result: reads passed filter: 7794 reads failed due to low quality: 3316 reads failed due to too many N: 0 reads failed due to too short: 171116 reads with adapter trimmed: 93744 bases trimmed due to adapters: 3516535 Duplication rate: 47.3269% Insert size peak (evaluated by paired-end reads): 87 JSON report: NTC_0001_0001_A23YTGFLT4_1.fastp.json HTML report: NTC_0001_0001_A23YTGFLT4_1.fastp.html fastp --in1 NTC_0001_0001_A23YTGFLT4_1_1.fastq.gz --in2 NTC_0001_0001_A23YTGFLT4_1_2.fastq.gz --out1 NTC_0001_0001_A23YTGFLT4_1_1.fastp.fastq.gz --out2 NTC_0001_0001_A23YTGFLT4_1_2.fastp.fastq.gz --json NTC_0001_0001_A23YTGFLT4_1.fastp.json --html NTC_0001_0001_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 fastp v0.23.4, time used: 2 seconds