Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 30429186 total bases: 4594807086 Q20 bases: 4436453530(96.5536%) Q30 bases: 4194451948(91.2868%) Read2 before filtering: total reads: 30429186 total bases: 4594807086 Q20 bases: 4463594163(97.1443%) Q30 bases: 4211992843(91.6685%) Read1 after filtering: total reads: 29706015 total bases: 3243555507 Q20 bases: 3227942002(99.5186%) Q30 bases: 3160168473(97.4291%) Read2 after filtering: total reads: 29706015 total bases: 3254064563 Q20 bases: 3225788010(99.131%) Q30 bases: 3137373427(96.414%) Filtering result: reads passed filter: 59412030 reads failed due to low quality: 1024758 reads failed due to too many N: 1926 reads failed due to too short: 419658 reads with adapter trimmed: 49718284 bases trimmed due to adapters: 2506898340 Duplication rate: 40.7038% Insert size peak (evaluated by paired-end reads): 95 JSON report: aih-tih-sc-0754d2-R1_A23YTGFLT4_1.fastp.json HTML report: aih-tih-sc-0754d2-R1_A23YTGFLT4_1.fastp.html fastp --in1 aih-tih-sc-0754d2-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-0754d2-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-0754d2-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-0754d2-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-0754d2-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-0754d2-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 fastp v0.23.4, time used: 54 seconds