Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 34070927
total bases: 5144709977
Q20 bases: 4860813720(94.4818%)
Q30 bases: 4462215185(86.734%)
Read2 before filtering:
total reads: 34070927
total bases: 5144709977
Q20 bases: 4981252648(96.8228%)
Q30 bases: 4653753249(90.4571%)
Read1 after filtering:
total reads: 33031530
total bases: 3136700278
Q20 bases: 3110965715(99.1796%)
Q30 bases: 3027167293(96.508%)
Read2 after filtering:
total reads: 33031530
total bases: 3147661684
Q20 bases: 3124107765(99.2517%)
Q30 bases: 3044648218(96.7273%)
Filtering result:
reads passed filter: 66063060
reads failed due to low quality: 1155268
reads failed due to too many N: 1770
reads failed due to too short: 921756
reads with adapter trimmed: 63071749
bases trimmed due to adapters: 3743473101
Duplication rate: 28.9804%
Insert size peak (evaluated by paired-end reads): 87
JSON report: aih-tih-sc-24ecfe-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-24ecfe-R1_A23YTGFLT4_1.fastp.html
fastp --in1 aih-tih-sc-24ecfe-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-24ecfe-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-24ecfe-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-24ecfe-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-24ecfe-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-24ecfe-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000
fastp v0.23.4, time used: 58 seconds