Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 61714805 total bases: 9318935555 Q20 bases: 9010588461(96.6912%) Q30 bases: 8561391144(91.8709%) Read2 before filtering: total reads: 61714805 total bases: 9318935555 Q20 bases: 9099122890(97.6412%) Q30 bases: 8636650527(92.6785%) Read1 after filtering: total reads: 60743285 total bases: 6674791650 Q20 bases: 6644490796(99.546%) Q30 bases: 6507614497(97.4954%) Read2 after filtering: total reads: 60743285 total bases: 6686971859 Q20 bases: 6639487229(99.2899%) Q30 bases: 6474518184(96.8229%) Filtering result: reads passed filter: 121486570 reads failed due to low quality: 1428564 reads failed due to too many N: 3890 reads failed due to too short: 510586 reads with adapter trimmed: 101483537 bases trimmed due to adapters: 5028060681 Duplication rate: 42.0221% Insert size peak (evaluated by paired-end reads): 97 JSON report: aih-tih-sc-598a93-R1_A23YTGFLT4_1.fastp.json HTML report: aih-tih-sc-598a93-R1_A23YTGFLT4_1.fastp.html fastp --in1 aih-tih-sc-598a93-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-598a93-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-598a93-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-598a93-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-598a93-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-598a93-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 fastp v0.23.4, time used: 117 seconds