Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 130184139
total bases: 19657804989
Q20 bases: 19263590632(97.9946%)
Q30 bases: 18632908351(94.7863%)

Read2 before filtering:
total reads: 130184139
total bases: 19657804989
Q20 bases: 19318810235(98.2755%)
Q30 bases: 18576330002(94.4985%)

Read1 after filtering:
total reads: 128811120
total bases: 16399248137
Q20 bases: 16337455950(99.6232%)
Q30 bases: 16033139623(97.7675%)

Read2 after filtering:
total reads: 128811120
total bases: 16410809712
Q20 bases: 16312401230(99.4003%)
Q30 bases: 15933683045(97.0926%)

Filtering result:
reads passed filter: 257622240
reads failed due to low quality: 2674792
reads failed due to too many N: 9606
reads failed due to too short: 61640
reads with adapter trimmed: 146366944
bases trimmed due to adapters: 6130767803

Duplication rate: 19.4394%

Insert size peak (evaluated by paired-end reads): 109

JSON report: aih-tih-sc-3b436b-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-3b436b-R1_A23YTGFLT4_1.fastp.html

fastp --in1 aih-tih-sc-3b436b-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-3b436b-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-3b436b-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-3b436b-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-3b436b-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-3b436b-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 286 seconds