Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 196693752
total bases: 29700756552
Q20 bases: 28914782582(97.3537%)
Q30 bases: 27714205270(93.3114%)

Read2 before filtering:
total reads: 196693752
total bases: 29700756552
Q20 bases: 29033528375(97.7535%)
Q30 bases: 27702256786(93.2712%)

Read1 after filtering:
total reads: 194210175
total bases: 22679233950
Q20 bases: 22579071392(99.5584%)
Q30 bases: 22121425798(97.5404%)

Read2 after filtering:
total reads: 194210175
total bases: 22706632173
Q20 bases: 22566428390(99.3825%)
Q30 bases: 22051428256(97.1145%)

Filtering result:
reads passed filter: 388420350
reads failed due to low quality: 4712860
reads failed due to too many N: 14252
reads failed due to too short: 240042
reads with adapter trimmed: 295565564
bases trimmed due to adapters: 13369317889

Duplication rate: 29.9467%

Insert size peak (evaluated by paired-end reads): 97

JSON report: aih-tih-sc-4bcd26-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-4bcd26-R1_A23YTGFLT4_1.fastp.html

fastp --in1 aih-tih-sc-4bcd26-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-4bcd26-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-4bcd26-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-4bcd26-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-4bcd26-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-4bcd26-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 416 seconds