Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 156991583
total bases: 23705729033
Q20 bases: 23272458801(98.1723%)
Q30 bases: 22528433376(95.0337%)

Read2 before filtering:
total reads: 156991583
total bases: 23705729033
Q20 bases: 23265485502(98.1429%)
Q30 bases: 22322209618(94.1638%)

Read1 after filtering:
total reads: 154970419
total bases: 19910976470
Q20 bases: 19829626942(99.5914%)
Q30 bases: 19444163551(97.6555%)

Read2 after filtering:
total reads: 154970419
total bases: 19925330573
Q20 bases: 19790939369(99.3255%)
Q30 bases: 19298497130(96.8541%)

Filtering result:
reads passed filter: 309940838
reads failed due to low quality: 3937632
reads failed due to too many N: 12134
reads failed due to too short: 92562
reads with adapter trimmed: 170300525
bases trimmed due to adapters: 7020605473

Duplication rate: 22.3057%

Insert size peak (evaluated by paired-end reads): 117

JSON report: aih-tih-sc-8e3550-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-8e3550-R1_A23YTGFLT4_1.fastp.html

fastp --in1 aih-tih-sc-8e3550-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-8e3550-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-8e3550-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-8e3550-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-8e3550-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-8e3550-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 331 seconds