Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 232958529
total bases: 35176737879
Q20 bases: 34473702673(98.0014%)
Q30 bases: 33265271165(94.5661%)

Read2 before filtering:
total reads: 232958529
total bases: 35176737879
Q20 bases: 34582545846(98.3108%)
Q30 bases: 33250560034(94.5243%)

Read1 after filtering:
total reads: 230311121
total bases: 28787064897
Q20 bases: 28670280082(99.5943%)
Q30 bases: 28120615538(97.6849%)

Read2 after filtering:
total reads: 230311121
total bases: 28810768372
Q20 bases: 28629774692(99.3718%)
Q30 bases: 27956271333(97.0341%)

Filtering result:
reads passed filter: 460622242
reads failed due to low quality: 5094528
reads failed due to too many N: 18374
reads failed due to too short: 181914
reads with adapter trimmed: 286037938
bases trimmed due to adapters: 12042470556

Duplication rate: 24.7739%

Insert size peak (evaluated by paired-end reads): 109

JSON report: aih-tih-sc-b567d0-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-b567d0-R1_A23YTGFLT4_1.fastp.html

fastp --in1 aih-tih-sc-b567d0-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-b567d0-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-b567d0-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-b567d0-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-b567d0-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-b567d0-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 465 seconds