File Info

Filename
aih-tih-sc-e1cae1-R1_A23YTGFLT4_1.fastp.log
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/6e/b50572d24400468e966908dcf86868/aih-tih-sc-e1cae1-R1_A23YTGFLT4_1.fastp.log
Size
1.6 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 177544517
total bases: 26809222067
Q20 bases: 26022762879(97.0665%)
Q30 bases: 24905826763(92.9002%)

Read2 before filtering:
total reads: 177544517
total bases: 26809222067
Q20 bases: 26256196213(97.9372%)
Q30 bases: 25053843046(93.4523%)

Read1 after filtering:
total reads: 175278499
total bases: 20293897036
Q20 bases: 20201074821(99.5426%)
Q30 bases: 19787194397(97.5032%)

Read2 after filtering:
total reads: 175278499
total bases: 20318746241
Q20 bases: 20190379959(99.3682%)
Q30 bases: 19720933241(97.0578%)

Filtering result:
reads passed filter: 350556998
reads failed due to low quality: 3931894
reads failed due to too many N: 12776
reads failed due to too short: 587366
reads with adapter trimmed: 269399946
bases trimmed due to adapters: 12416123088

Duplication rate: 39.8305%

Insert size peak (evaluated by paired-end reads): 99

JSON report: aih-tih-sc-e1cae1-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-e1cae1-R1_A23YTGFLT4_1.fastp.html

fastp --in1 aih-tih-sc-e1cae1-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-e1cae1-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-e1cae1-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-e1cae1-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-e1cae1-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-e1cae1-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 388 seconds