Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44349905881(97.9027%)
Q30 bases: 42680041147(94.2164%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44488117158(98.2078%)
Q30 bases: 42622265326(94.0889%)

Read1 after filtering:
total reads: 296820409
total bases: 36395220930
Q20 bases: 36243470348(99.583%)
Q30 bases: 35501205061(97.5436%)

Read2 after filtering:
total reads: 296820409
total bases: 36429263205
Q20 bases: 36187745374(99.337%)
Q30 bases: 35286767897(96.8638%)

Filtering result:
reads passed filter: 593640818
reads failed due to low quality: 6152642
reads failed due to too many N: 21384
reads failed due to too short: 185156
reads with adapter trimmed: 394559398
bases trimmed due to adapters: 16928641261

Duplication rate: 33.294%

Insert size peak (evaluated by paired-end reads): 109

JSON report: aih-tih-sc-b6a2e8-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-b6a2e8-R1_A23YTGFLT4_1.fastp.html

fastp --in1 aih-tih-sc-b6a2e8-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-b6a2e8-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-b6a2e8-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-b6a2e8-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-b6a2e8-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-b6a2e8-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 575 seconds