Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44412399813(98.0406%)
Q30 bases: 42864308161(94.6232%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44433725891(98.0877%)
Q30 bases: 42583237958(94.0027%)

Read1 after filtering:
total reads: 296109161
total bases: 37166744768
Q20 bases: 37015946958(99.5943%)
Q30 bases: 36303274994(97.6768%)

Read2 after filtering:
total reads: 296109161
total bases: 37197687299
Q20 bases: 36946851736(99.3257%)
Q30 bases: 36025337060(96.8483%)

Filtering result:
reads passed filter: 592218322
reads failed due to low quality: 7534714
reads failed due to too many N: 22474
reads failed due to too short: 224490
reads with adapter trimmed: 345434495
bases trimmed due to adapters: 15182281492

Duplication rate: 28.8625%

Insert size peak (evaluated by paired-end reads): 108

JSON report: aih-tih-sc-e08fa3-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-e08fa3-R1_A23YTGFLT4_1.fastp.html

fastp --in1 aih-tih-sc-e08fa3-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-e08fa3-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-e08fa3-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-e08fa3-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-e08fa3-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-e08fa3-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 679 seconds