MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-05-16, 15:14 UTC based on data in: /tmp/nxf.ZSwdKF4FRs

General Statistics

Showing ⁴⁸⁰/₄₈₀ rows and ⁵⁵/₆₂ columns.

Sample Name	Total Reads	Expected Distinct	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	Reads	Frac Unmapped	Frac Dupes	Unique Reads	Frac Reads On Target	Frac Pairs On Target	Frac Reads Off Target	Frac Pairs Off Target	Reads On Target	Pairs On Target	Reads Off Target	Pairs Off Target	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	N Q30	GC Bias	RNA contaminated	RNA contamination %	Frag Length	% Aligned	M Aligned	Insert Size	Mean Insert Size	Duplication	rRNA	mRNA	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
FFPE_HD789_02_RNA_0005_23KKJ7LT4_1	9999000000	339689223	177.8bp	163.0bp	0.67%	1.53%	0.89%	0.00%	1.41%	4.40%	1.16%	0.00%	593137770	0.01%	0.49%	300297853	0.71%	0.73%	0.28%	0.27%	212092951	108153992	84061344	39340401	480.94	189.00	0.69%	0.58%	0.98	0.000	Yes	63.78%				204bp	385bp	49.7%	0.0%	82.5%	84.6%	94.5%	280.4M	39.2%	98.0%	81703.0Mb	593.1M	53.9%	98.9%	32.9%
FFPE_HD789_02_RNA_0005_23KKJ7LT4_1_1																																	177.8bp	81.5%	241.8M																79.9%	53%	151bp	151bp	27%	532.4M
FFPE_HD789_02_RNA_0005_23KKJ7LT4_1_2																																																			78.4%	54%	151bp	151bp	18%	532.4M
FFPE_HD789_02_RNA_0005_23KKJ7LT4_1_trimmed_1																																																			74.6%	53%	141bp	151bp	27%	296.6M	74.6%	53%	141bp	151bp	27%	296.6M
FFPE_HD789_02_RNA_0005_23KKJ7LT4_1_trimmed_2																																																			73.8%	54%	141bp	151bp	18%	296.6M	73.8%	54%	141bp	151bp	18%	296.6M
FFPE_HD789_02_RNA_0006_23KKJ7LT4_1	9999000000	330048754	169.1bp	155.0bp	0.41%	1.44%	0.80%	0.00%	0.82%	4.10%	1.08%	0.00%	592549374	0.01%	0.49%	304190045	0.76%	0.79%	0.23%	0.21%	232078550	118039383	68590963	31672227	513.70	206.00	0.70%	0.59%	0.98	0.000	Yes	63.95%				196bp	399bp	49.0%	0.0%	86.8%	86.1%	95.0%	281.6M	39.1%	97.7%	80044.0Mb	592.5M	54.4%	98.8%	38.9%
FFPE_HD789_02_RNA_0006_23KKJ7LT4_1_1																																	169.1bp	86.2%	255.3M																82.5%	54%	151bp	151bp	27%	557.6M
FFPE_HD789_02_RNA_0006_23KKJ7LT4_1_2																																																			81.4%	54%	151bp	151bp	18%	557.6M
FFPE_HD789_02_RNA_0006_23KKJ7LT4_1_trimmed_1																																																			77.2%	54%	138bp	151bp	18%	296.3M	77.2%	54%	138bp	151bp	18%	296.3M
FFPE_HD789_02_RNA_0006_23KKJ7LT4_1_trimmed_2																																																			76.8%	54%	138bp	151bp	9%	296.3M	76.8%	54%	138bp	151bp	9%	296.3M
FFPE_V4_0001_RNA_0002_23KKJ7LT4_1	9999000000	230952763	159.6bp	148.0bp	0.40%	1.46%	1.35%	0.00%	0.73%	3.94%	1.75%	0.00%	555296858	0.01%	0.55%	249885521	0.71%	0.74%	0.27%	0.26%	176789347	89824124	68374158	32259735	375.06	87.00	0.57%	0.49%	0.98	0.000	No	0.00%				174bp	311bp	55.5%	0.0%	83.3%	83.3%	93.9%	260.8M	42.4%	97.7%	73607.4Mb	555.3M	53.8%	98.5%	44.3%
FFPE_V4_0001_RNA_0002_23KKJ7LT4_1_1																																	159.6bp	81.7%	226.8M																77.1%	53%	151bp	151bp	27%	281.9M
FFPE_V4_0001_RNA_0002_23KKJ7LT4_1_2																																																			76.3%	54%	151bp	151bp	18%	281.9M
FFPE_V4_0001_RNA_0002_23KKJ7LT4_1_trimmed_1																																																			77.1%	53%	136bp	151bp	18%	277.6M	77.1%	53%	136bp	151bp	18%	277.6M
FFPE_V4_0001_RNA_0002_23KKJ7LT4_1_trimmed_2																																																			77.0%	54%	136bp	151bp	9%	277.6M	77.0%	54%	136bp	151bp	9%	277.6M
FFPE_V4_0001_RNA_0003_23KKJ7LT4_1	9999000000	250708718	163.2bp	150.0bp	0.66%	1.56%	1.44%	0.00%	1.20%	4.21%	1.82%	0.00%	591740366	0.01%	0.55%	264851117	0.62%	0.65%	0.36%	0.35%	164744667	83798707	94210135	45198276	350.06	81.00	0.57%	0.48%	0.98	0.000	No	0.00%				172bp	273bp	55.8%	0.0%	77.6%	82.0%	93.4%	276.3M	42.6%	98.0%	79229.8Mb	591.7M	53.3%	98.6%	42.1%
FFPE_V4_0001_RNA_0003_23KKJ7LT4_1_1																																	163.2bp	75.5%	223.5M																76.7%	52%	151bp	151bp	36%	337.9M
FFPE_V4_0001_RNA_0003_23KKJ7LT4_1_2																																																			75.3%	53%	151bp	151bp	18%	337.9M
FFPE_V4_0001_RNA_0003_23KKJ7LT4_1_trimmed_1																																																			75.3%	53%	137bp	151bp	18%	295.9M	75.3%	53%	137bp	151bp	18%	295.9M
FFPE_V4_0001_RNA_0003_23KKJ7LT4_1_trimmed_2																																																			74.7%	53%	137bp	151bp	18%	295.9M	74.7%	53%	137bp	151bp	18%	295.9M
NTC_0001_0001_23KKJ7LT4_1	9999000000	116915	40.6bp	31.0bp	0.01%	0.01%	0.00%	0.00%	0.02%	0.01%	0.00%	0.00%	811668	0.57%	0.35%	526003	0.00%	0.03%	0.12%	0.97%	1776	850	60816	29011	0.00	0.00	0.00%	0.00%	0.93	0.000	Skipped	N/A%				22bp	25bp	82.0%	2.0%	4.8%	2.2%	7.6%	0.0M	74.1%	93.7%	68.6Mb	0.8M	65.6%	6.6%	51.5%
NTC_0001_0001_23KKJ7LT4_1_1																																	40.6bp	2.3%	0.0M																97.4%	74%	151bp	151bp	64%	6.2M
NTC_0001_0001_23KKJ7LT4_1_2																																																			96.7%	96%	151bp	151bp	55%	6.2M
NTC_0001_0001_23KKJ7LT4_1_trimmed_1																																																			65.9%	63%	89bp	97bp	36%	0.4M	65.9%	63%	89bp	97bp	36%	0.4M
NTC_0001_0001_23KKJ7LT4_1_trimmed_2																																																			66.5%	67%	91bp	102bp	36%	0.4M	66.5%	67%	91bp	102bp	36%	0.4M
NTC_0001_0001_23KKJ7LT4_2	9999000000	150022	38.1bp	31.0bp	0.02%	0.03%	0.03%	0.00%	0.02%	0.09%	0.08%	0.00%	745474	0.51%	0.40%	445705	0.00%	0.03%	0.15%	0.97%	1905	913	66290	31755	0.00	0.00	0.00%	0.00%	0.91	0.000	Skipped	N/A%				23bp	26bp	81.5%	2.4%	4.8%	2.1%	8.7%	0.0M	73.4%	93.2%	58.0Mb	0.7M	64.4%	7.3%	52.1%
NTC_0001_0001_23KKJ7LT4_2_1																																	38.1bp	3.5%	0.0M																97.3%	74%	151bp	151bp	55%	5.1M
NTC_0001_0001_23KKJ7LT4_2_2																																																			96.3%	96%	151bp	151bp	55%	5.1M
NTC_0001_0001_23KKJ7LT4_2_trimmed_1																																																			66.9%	63%	83bp	77bp	27%	0.4M	66.9%	63%	83bp	77bp	27%	0.4M
NTC_0001_0001_23KKJ7LT4_2_trimmed_2																																																			67.1%	65%	84bp	82bp	27%	0.4M	67.1%	65%	84bp	82bp	27%	0.4M
tih_rna_sample_00001_23KKJ7LT4_1	9999000000	225676080	152.4bp	142.0bp	1.06%	0.71%	0.54%	0.00%	2.13%	2.17%	0.78%	0.00%	589849240	0.01%	0.58%	248594215	0.52%	0.55%	0.45%	0.45%	129603717	65806321	111387984	54267924	256.26	116.00	0.68%	0.53%	0.98	0.000	No	0.00%				155bp	207bp	58.6%	0.0%	72.2%	81.2%	92.8%	273.8M	42.8%	98.0%	77458.9Mb	589.8M	52.1%	98.3%	48.6%
tih_rna_sample_00001_23KKJ7LT4_1_1																																	152.4bp	71.5%	210.9M																72.0%	51%	151bp	151bp	27%	310.5M
tih_rna_sample_00001_23KKJ7LT4_1_2																																																			71.0%	52%	151bp	151bp	18%	310.5M
tih_rna_sample_00001_23KKJ7LT4_1_trimmed_1																																																			71.4%	51%	134bp	151bp	18%	294.9M	71.4%	51%	134bp	151bp	18%	294.9M
tih_rna_sample_00001_23KKJ7LT4_1_trimmed_2																																																			71.0%	52%	134bp	151bp	18%	294.9M	71.0%	52%	134bp	151bp	18%	294.9M
tih_rna_sample_00002_23KKJ7LT4_1	9999000000	334945510	149.0bp	140.0bp	0.64%	0.85%	0.46%	0.00%	1.48%	2.74%	0.64%	0.00%	592671596	0.01%	0.47%	315442982	0.50%	0.51%	0.49%	0.49%	156469510	79334518	153203898	75089795	304.24	169.00	0.74%	0.60%	0.98	0.000	No	0.00%				150bp	186bp	47.2%	0.0%	63.6%	85.3%	94.6%	280.4M	34.8%	98.1%	77093.2Mb	592.7M	49.8%	98.8%	51.0%
tih_rna_sample_00002_23KKJ7LT4_1_1																																	149.0bp	64.2%	190.4M																65.5%	49%	151bp	151bp	27%	302.3M
tih_rna_sample_00002_23KKJ7LT4_1_2																																																			63.2%	50%	151bp	151bp	18%	302.3M
tih_rna_sample_00002_23KKJ7LT4_1_trimmed_1																																																			65.3%	49%	133bp	147bp	18%	296.3M	65.3%	49%	133bp	147bp	18%	296.3M
tih_rna_sample_00002_23KKJ7LT4_1_trimmed_2																																																			63.5%	50%	133bp	147bp	9%	296.3M	63.5%	50%	133bp	147bp	9%	296.3M
tih_rna_sample_00004_23KKJ7LT4_1	9999000000	327704719	158.0bp	148.0bp	0.83%	0.61%	0.53%	0.00%	1.72%	1.87%	0.75%	0.00%	592806584	0.01%	0.49%	299936428	0.59%	0.62%	0.39%	0.38%	177737544	90340618	116390166	56281823	367.14	171.00	0.73%	0.59%	0.98	0.000	No	0.00%				164bp	235bp	49.9%	0.0%	73.6%	83.8%	94.1%	278.8M	37.8%	98.1%	78789.3Mb	592.8M	51.9%	98.8%	44.1%
tih_rna_sample_00004_23KKJ7LT4_1_1																																	158.0bp	72.9%	216.0M																75.2%	51%	151bp	151bp	27%	471.3M
tih_rna_sample_00004_23KKJ7LT4_1_2																																																			73.3%	52%	151bp	151bp	18%	471.3M
tih_rna_sample_00004_23KKJ7LT4_1_trimmed_1																																																			70.1%	51%	135bp	151bp	27%	296.4M	70.1%	51%	135bp	151bp	27%	296.4M
tih_rna_sample_00004_23KKJ7LT4_1_trimmed_2																																																			68.8%	52%	136bp	151bp	18%	296.4M	68.8%	52%	136bp	151bp	18%	296.4M
tih_rna_sample_00005_23KKJ7LT4_1	9999000000	85870309	130.9bp	125.0bp	0.93%	1.05%	0.75%	0.00%	1.83%	2.98%	0.99%	0.00%	374130928	0.02%	0.71%	109650283	0.40%	0.43%	0.54%	0.57%	43364286	21917330	58717833	28886982	71.14	27.00	0.49%	0.21%	0.98	0.000	No	0.00%				129bp	161bp	72.2%	0.0%	73.1%	70.5%	89.8%	167.9M	48.2%	97.7%	45115.3Mb	374.1M	54.1%	93.9%	65.9%
tih_rna_sample_00005_23KKJ7LT4_1_1																																	130.9bp	70.6%	132.1M																77.4%	54%	151bp	151bp	45%	199.3M
tih_rna_sample_00005_23KKJ7LT4_1_2																																																			75.5%	56%	151bp	151bp	45%	199.3M
tih_rna_sample_00005_23KKJ7LT4_1_trimmed_1																																																			76.2%	53%	123bp	132bp	18%	187.1M	76.2%	53%	123bp	132bp	18%	187.1M
tih_rna_sample_00005_23KKJ7LT4_1_trimmed_2																																																			75.0%	54%	124bp	132bp	9%	187.1M	75.0%	54%	124bp	132bp	9%	187.1M
tih_rna_sample_00006_23KKJ7LT4_1	9999000000	312636088	135.5bp	128.0bp	1.49%	1.25%	0.81%	0.00%	3.16%	3.60%	1.09%	0.00%	590943080	0.01%	0.50%	293732314	0.59%	0.61%	0.39%	0.39%	172382930	87107345	113832717	55567033	313.49	133.00	0.69%	0.55%	0.98	0.000	No	0.00%				138bp	181bp	50.9%	0.0%	75.6%	77.3%	92.2%	272.4M	33.1%	97.9%	73392.8Mb	590.9M	53.9%	98.5%	61.6%
tih_rna_sample_00006_23KKJ7LT4_1_1																																	135.5bp	74.1%	218.8M																71.6%	53%	151bp	151bp	27%	344.5M
tih_rna_sample_00006_23KKJ7LT4_1_2																																																			70.1%	54%	151bp	151bp	27%	344.5M
tih_rna_sample_00006_23KKJ7LT4_1_trimmed_1																																																			69.8%	53%	127bp	137bp	18%	295.5M	69.8%	53%	127bp	137bp	18%	295.5M
tih_rna_sample_00006_23KKJ7LT4_1_trimmed_2																																																			69.0%	54%	127bp	137bp	18%	295.5M	69.0%	54%	127bp	137bp	18%	295.5M
tih_rna_sample_00007_23KKJ7LT4_1	9999000000	289738546	153.4bp	144.0bp	0.94%	0.93%	0.63%	0.00%	2.05%	2.90%	0.85%	0.00%	588564118	0.01%	0.51%	288968599	0.53%	0.55%	0.45%	0.45%	151981391	77087333	129572396	63241435	303.47	153.00	0.72%	0.58%	0.98	0.000	No	0.00%				153bp	197bp	51.6%	0.0%	69.4%	80.9%	93.2%	274.2M	37.2%	97.9%	76683.7Mb	588.6M	52.2%	98.1%	49.3%
tih_rna_sample_00007_23KKJ7LT4_1_1																																	153.4bp	68.3%	200.9M																70.5%	52%	151bp	151bp	27%	366.3M
tih_rna_sample_00007_23KKJ7LT4_1_2																																																			69.2%	52%	151bp	151bp	18%	366.3M
tih_rna_sample_00007_23KKJ7LT4_1_trimmed_1																																																			67.4%	52%	133bp	151bp	18%	294.3M	67.4%	52%	133bp	151bp	18%	294.3M
tih_rna_sample_00007_23KKJ7LT4_1_trimmed_2																																																			66.9%	52%	133bp	151bp	18%	294.3M	66.9%	52%	133bp	151bp	18%	294.3M
tih_rna_sample_00008_23KKJ7LT4_1	9999000000	51767500	112.8bp	110.0bp	0.60%	0.52%	0.29%	0.00%	1.50%	1.61%	0.39%	0.00%	140156974	0.03%	0.62%	53034704	0.20%	0.22%	0.73%	0.78%	10478680	5283062	38780907	19266956	14.42	6.00	0.12%	0.01%	0.98	0.000	No	0.00%				109bp	116bp	63.9%	0.0%	51.5%	66.3%	88.9%	62.3M	36.1%	97.3%	14976.1Mb	140.2M	51.6%	91.4%	80.2%
tih_rna_sample_00008_23KKJ7LT4_1_1																																	112.8bp	49.9%	35.0M																66.2%	54%	151bp	151bp	36%	76.7M
tih_rna_sample_00008_23KKJ7LT4_1_2																																																			65.2%	55%	151bp	151bp	55%	76.7M
tih_rna_sample_00008_23KKJ7LT4_1_trimmed_1																																																			63.3%	51%	110bp	112bp	18%	70.1M	63.3%	51%	110bp	112bp	18%	70.1M
tih_rna_sample_00008_23KKJ7LT4_1_trimmed_2																																																			62.8%	51%	110bp	112bp	9%	70.1M	62.8%	51%	110bp	112bp	9%	70.1M
tih_rna_sample_00009_23KKJ7LT4_1	9999000000	217038141	139.6bp	133.0bp	0.98%	1.30%	0.79%	0.00%	2.02%	3.72%	1.10%	0.00%	584642761	0.03%	0.58%	246028903	0.51%	0.55%	0.42%	0.45%	124702838	63077009	103665641	50662439	223.94	79.00	0.65%	0.45%	0.98	0.000	No	0.00%				139bp	172bp	59.7%	0.0%	73.6%	71.0%	88.9%	259.9M	39.4%	97.6%	72795.0Mb	584.6M	58.2%	97.4%	60.2%
tih_rna_sample_00009_23KKJ7LT4_1_1																																	139.6bp	70.9%	207.3M																77.5%	57%	151bp	151bp	27%	403.6M
tih_rna_sample_00009_23KKJ7LT4_1_2																																																			75.6%	58%	151bp	151bp	36%	403.6M
tih_rna_sample_00009_23KKJ7LT4_1_trimmed_1																																																			73.8%	58%	127bp	137bp	18%	292.3M	73.8%	58%	127bp	137bp	18%	292.3M
tih_rna_sample_00009_23KKJ7LT4_1_trimmed_2																																																			72.8%	58%	128bp	137bp	18%	292.3M	72.8%	58%	128bp	137bp	18%	292.3M
tih_rna_sample_00010_23KKJ7LT4_1	9999000000	323392918	145.0bp	137.0bp	0.54%	0.62%	0.75%	0.00%	1.28%	2.01%	1.02%	0.00%	592797774	0.01%	0.50%	294481777	0.61%	0.63%	0.37%	0.37%	179468653	90808048	108317549	52673797	345.53	158.00	0.71%	0.58%	0.98	0.000	No	0.00%				150bp	219bp	50.9%	0.0%	77.4%	85.3%	94.5%	280.2M	35.7%	98.0%	76404.9Mb	592.8M	52.3%	98.8%	54.7%
tih_rna_sample_00010_23KKJ7LT4_1_1																																	145.0bp	76.6%	227.2M																75.2%	52%	151bp	151bp	27%	414.5M
tih_rna_sample_00010_23KKJ7LT4_1_2																																																			73.4%	52%	151bp	151bp	18%	414.5M
tih_rna_sample_00010_23KKJ7LT4_1_trimmed_1																																																			71.6%	52%	131bp	142bp	27%	296.4M	71.6%	52%	131bp	142bp	27%	296.4M
tih_rna_sample_00010_23KKJ7LT4_1_trimmed_2																																																			70.4%	52%	132bp	147bp	18%	296.4M	70.4%	52%	132bp	147bp	18%	296.4M
tih_rna_sample_00012_23KKJ7LT4_1	9999000000	267895575	135.6bp	128.0bp	0.60%	0.89%	0.67%	0.00%	1.37%	2.95%	0.95%	0.00%	589707816	0.02%	0.54%	273837141	0.52%	0.55%	0.45%	0.45%	142508004	72011935	122250760	59986218	256.26	117.00	0.70%	0.53%	0.98	0.000	No	0.00%				138bp	178bp	54.4%	0.0%	72.1%	80.5%	92.8%	273.8M	36.0%	97.9%	73239.6Mb	589.7M	53.1%	98.3%	61.8%
tih_rna_sample_00012_23KKJ7LT4_1_1																																	135.6bp	71.0%	209.3M																71.7%	52%	151bp	151bp	27%	364.4M
tih_rna_sample_00012_23KKJ7LT4_1_2																																																			70.4%	53%	151bp	151bp	18%	364.4M
tih_rna_sample_00012_23KKJ7LT4_1_trimmed_1																																																			69.0%	52%	127bp	137bp	18%	294.9M	69.0%	52%	127bp	137bp	18%	294.9M
tih_rna_sample_00012_23KKJ7LT4_1_trimmed_2																																																			68.2%	53%	127bp	137bp	18%	294.9M	68.2%	53%	127bp	137bp	18%	294.9M
tih_rna_sample_00013_23KKJ7LT4_1	9999000000	172829628	137.7bp	131.0bp	0.63%	0.87%	0.55%	0.00%	1.41%	2.78%	0.79%	0.00%	455139818	0.02%	0.59%	185319769	0.41%	0.44%	0.54%	0.56%	76022063	38455256	100806216	49665752	134.20	62.00	0.63%	0.38%	0.98	0.000	No	0.00%				137bp	164bp	60.4%	0.0%	67.3%	77.2%	91.8%	208.9M	40.8%	97.7%	56893.0Mb	455.1M	53.4%	97.8%	61.2%
tih_rna_sample_00013_23KKJ7LT4_1_1																																	137.7bp	65.9%	150.0M																69.0%	53%	151bp	151bp	27%	232.7M
tih_rna_sample_00013_23KKJ7LT4_1_2																																																			67.1%	54%	151bp	151bp	18%	232.7M
tih_rna_sample_00013_23KKJ7LT4_1_trimmed_1																																																			68.7%	53%	128bp	137bp	18%	227.6M	68.7%	53%	128bp	137bp	18%	227.6M
tih_rna_sample_00013_23KKJ7LT4_1_trimmed_2																																																			67.6%	53%	128bp	137bp	9%	227.6M	67.6%	53%	128bp	137bp	9%	227.6M
tih_rna_sample_00015_23KKJ7LT4_1	9999000000	294478437	158.4bp	147.0bp	0.95%	0.45%	0.44%	0.00%	2.32%	1.55%	0.66%	0.00%	592910060	0.01%	0.54%	274433549	0.58%	0.60%	0.40%	0.40%	158223647	80398618	110822574	53687703	325.38	162.00	0.74%	0.60%	0.98	0.000	No	0.00%				174bp	270bp	54.2%	0.0%	74.2%	84.5%	94.4%	279.9M	39.7%	97.8%	78746.1Mb	592.9M	53.7%	98.8%	44.5%
tih_rna_sample_00015_23KKJ7LT4_1_1																																	158.4bp	73.6%	218.2M																75.9%	53%	151bp	151bp	36%	442.6M
tih_rna_sample_00015_23KKJ7LT4_1_2																																																			74.4%	54%	151bp	151bp	27%	442.6M
tih_rna_sample_00015_23KKJ7LT4_1_trimmed_1																																																			71.4%	53%	136bp	151bp	36%	296.5M	71.4%	53%	136bp	151bp	36%	296.5M
tih_rna_sample_00015_23KKJ7LT4_1_trimmed_2																																																			70.6%	53%	136bp	151bp	27%	296.5M	70.6%	53%	136bp	151bp	27%	296.5M
tih_rna_sample_00016_23KKJ7LT4_1	9999000000	130369730	128.4bp	123.0bp	1.02%	1.10%	0.45%	0.00%	2.51%	3.48%	0.69%	0.00%	432278850	0.02%	0.64%	154837992	0.29%	0.32%	0.64%	0.68%	45615461	23044003	98709208	48822812	73.71	30.00	0.50%	0.22%	0.98	0.000	No	0.00%				125bp	141bp	65.8%	0.0%	62.2%	68.8%	89.1%	192.5M	42.0%	97.4%	51199.7Mb	432.3M	54.9%	96.0%	69.4%
tih_rna_sample_00016_23KKJ7LT4_1_1																																	128.4bp	60.4%	130.6M																71.9%	54%	151bp	151bp	36%	225.1M
tih_rna_sample_00016_23KKJ7LT4_1_2																																																			70.0%	56%	151bp	151bp	36%	225.1M
tih_rna_sample_00016_23KKJ7LT4_1_trimmed_1																																																			71.1%	54%	121bp	127bp	18%	216.1M	71.1%	54%	121bp	127bp	18%	216.1M
tih_rna_sample_00016_23KKJ7LT4_1_trimmed_2																																																			70.1%	55%	122bp	127bp	9%	216.1M	70.1%	55%	122bp	127bp	9%	216.1M
tih_rna_sample_00020_23KKJ7LT4_1	9999000000	273731487	139.3bp	131.0bp	1.49%	0.90%	0.61%	0.00%	3.09%	2.72%	0.84%	0.00%	589650148	0.01%	0.53%	277578162	0.59%	0.62%	0.38%	0.38%	163181214	82525959	106083228	51658490	301.29	138.00	0.70%	0.56%	0.98	0.000	No	0.00%				139bp	182bp	53.7%	0.0%	76.6%	78.9%	92.7%	273.1M	36.0%	97.8%	73706.7Mb	589.7M	55.3%	98.3%	59.8%
tih_rna_sample_00020_23KKJ7LT4_1_1																																	139.3bp	75.1%	221.3M																74.4%	55%	151bp	151bp	27%	373.9M
tih_rna_sample_00020_23KKJ7LT4_1_2																																																			72.9%	55%	151bp	151bp	18%	373.9M
tih_rna_sample_00020_23KKJ7LT4_1_trimmed_1																																																			71.6%	55%	128bp	137bp	18%	294.8M	71.6%	55%	128bp	137bp	18%	294.8M
tih_rna_sample_00020_23KKJ7LT4_1_trimmed_2																																																			70.8%	55%	128bp	137bp	18%	294.8M	70.8%	55%	128bp	137bp	18%	294.8M
tih_rna_sample_00021_23KKJ7LT4_1	9999000000	262683933	159.3bp	149.0bp	0.69%	1.30%	0.67%	0.00%	1.46%	3.93%	0.94%	0.00%	591948044	0.01%	0.54%	274194303	0.61%	0.64%	0.37%	0.36%	167901427	85310380	100954104	48641338	349.91	150.00	0.69%	0.56%	0.98	0.000	No	0.00%				166bp	244bp	54.2%	0.0%	77.0%	82.2%	94.0%	278.1M	40.7%	97.9%	79072.8Mb	591.9M	53.8%	98.7%	44.2%
tih_rna_sample_00021_23KKJ7LT4_1_1																																	159.3bp	76.1%	225.3M																75.3%	53%	151bp	151bp	27%	354.5M
tih_rna_sample_00021_23KKJ7LT4_1_2																																																			73.9%	54%	151bp	151bp	18%	354.5M
tih_rna_sample_00021_23KKJ7LT4_1_trimmed_1																																																			73.2%	53%	136bp	151bp	18%	296.0M	73.2%	53%	136bp	151bp	18%	296.0M
tih_rna_sample_00021_23KKJ7LT4_1_trimmed_2																																																			72.6%	54%	136bp	151bp	18%	296.0M	72.6%	54%	136bp	151bp	18%	296.0M
tih_rna_sample_00022_23KKJ7LT4_1	9999000000	221702241	143.3bp	135.0bp	0.83%	0.57%	0.62%	0.00%	1.71%	1.74%	0.87%	0.00%	587391038	0.02%	0.59%	239242346	0.57%	0.61%	0.39%	0.39%	137233993	69440773	92876541	45212495	256.80	100.00	0.68%	0.50%	0.98	0.000	No	0.00%				146bp	201bp	60.2%	0.0%	78.7%	79.4%	92.5%	271.6M	40.5%	97.8%	74548.2Mb	587.4M	57.0%	97.9%	56.5%
tih_rna_sample_00022_23KKJ7LT4_1_1																																	143.3bp	76.5%	224.7M																76.0%	56%	151bp	151bp	27%	402.0M
tih_rna_sample_00022_23KKJ7LT4_1_2																																																			74.3%	56%	151bp	151bp	27%	402.0M
tih_rna_sample_00022_23KKJ7LT4_1_trimmed_1																																																			72.3%	56%	130bp	142bp	18%	293.7M	72.3%	56%	130bp	142bp	18%	293.7M
tih_rna_sample_00022_23KKJ7LT4_1_trimmed_2																																																			71.4%	57%	130bp	142bp	18%	293.7M	71.4%	57%	130bp	142bp	18%	293.7M
tih_rna_sample_00023_23KKJ7LT4_1	9999000000	303497604	147.4bp	139.0bp	1.31%	0.56%	0.58%	0.00%	2.98%	1.72%	0.79%	0.00%	592504336	0.01%	0.49%	299977483	0.54%	0.56%	0.44%	0.44%	161933796	82044895	131416112	64250604	314.58	154.00	0.71%	0.58%	0.98	0.000	No	0.00%				149bp	190bp	49.9%	0.0%	68.6%	83.4%	93.8%	278.0M	38.4%	98.1%	76731.8Mb	592.5M	50.4%	98.8%	51.7%
tih_rna_sample_00023_23KKJ7LT4_1_1																																	147.4bp	67.1%	198.7M																74.3%	50%	151bp	151bp	27%	454.8M
tih_rna_sample_00023_23KKJ7LT4_1_2																																																			72.5%	51%	151bp	151bp	18%	454.8M
tih_rna_sample_00023_23KKJ7LT4_1_trimmed_1																																																			69.1%	50%	132bp	147bp	27%	296.3M	69.1%	50%	132bp	147bp	27%	296.3M
tih_rna_sample_00023_23KKJ7LT4_1_trimmed_2																																																			67.8%	50%	132bp	147bp	18%	296.3M	67.8%	50%	132bp	147bp	18%	296.3M
tih_rna_sample_00024_23KKJ7LT4_1	9999000000	234514417	129.9bp	124.0bp	0.93%	1.23%	0.74%	0.00%	1.99%	3.59%	1.02%	0.00%	587520028	0.02%	0.57%	254834855	0.53%	0.57%	0.42%	0.43%	135208616	68277699	106198153	52019559	233.63	84.00	0.66%	0.47%	0.98	0.000	No	0.00%				131bp	163bp	57.9%	0.0%	74.3%	71.8%	89.9%	264.1M	37.2%	97.6%	70982.9Mb	587.5M	57.6%	97.9%	66.2%
tih_rna_sample_00024_23KKJ7LT4_1_1																																	129.9bp	71.7%	210.7M																73.0%	56%	151bp	151bp	27%	326.3M
tih_rna_sample_00024_23KKJ7LT4_1_2																																																			71.6%	57%	151bp	151bp	36%	326.3M
tih_rna_sample_00024_23KKJ7LT4_1_trimmed_1																																																			71.8%	57%	124bp	132bp	18%	293.8M	71.8%	57%	124bp	132bp	18%	293.8M
tih_rna_sample_00024_23KKJ7LT4_1_trimmed_2																																																			71.1%	57%	124bp	132bp	18%	293.8M	71.1%	57%	124bp	132bp	18%	293.8M
tih_rna_sample_00025_23KKJ7LT4_1	9999000000	275743675	130.0bp	123.0bp	2.03%	2.34%	0.97%	0.00%	4.12%	6.69%	1.30%	0.00%	591741850	0.01%	0.52%	283217552	0.49%	0.51%	0.48%	0.49%	139805372	70601854	137167131	67513197	242.01	107.00	0.68%	0.51%	0.98	0.000	No	0.00%				129bp	160bp	52.7%	0.0%	68.9%	82.4%	93.8%	277.6M	34.3%	98.0%	71551.3Mb	591.7M	49.1%	98.6%	67.2%
tih_rna_sample_00025_23KKJ7LT4_1_1																																	130.0bp	68.3%	202.1M																71.3%	49%	151bp	151bp	27%	334.5M
tih_rna_sample_00025_23KKJ7LT4_1_2																																																			68.5%	50%	151bp	151bp	27%	334.5M
tih_rna_sample_00025_23KKJ7LT4_1_trimmed_1																																																			69.8%	48%	123bp	127bp	18%	295.9M	69.8%	48%	123bp	127bp	18%	295.9M
tih_rna_sample_00025_23KKJ7LT4_1_trimmed_2																																																			67.5%	49%	123bp	127bp	18%	295.9M	67.5%	49%	123bp	127bp	18%	295.9M
tih_rna_sample_00027_23KKJ7LT4_1	9999000000	308787524	139.2bp	131.0bp	0.86%	0.66%	0.42%	0.00%	1.97%	2.11%	0.56%	0.00%	591873204	0.01%	0.50%	298767728	0.47%	0.49%	0.51%	0.51%	140167505	70915084	152543797	75054448	255.82	108.00	0.67%	0.51%	0.98	0.000	No	0.00%				138bp	167bp	50.0%	0.0%	64.3%	85.5%	94.8%	280.6M	34.4%	98.0%	74070.9Mb	591.9M	49.0%	98.6%	59.7%
tih_rna_sample_00027_23KKJ7LT4_1_1																																	139.2bp	64.1%	189.8M																69.1%	49%	151bp	151bp	27%	318.2M
tih_rna_sample_00027_23KKJ7LT4_1_2																																																			66.6%	50%	151bp	151bp	18%	318.2M
tih_rna_sample_00027_23KKJ7LT4_1_trimmed_1																																																			68.1%	48%	128bp	137bp	18%	295.9M	68.1%	48%	128bp	137bp	18%	295.9M
tih_rna_sample_00027_23KKJ7LT4_1_trimmed_2																																																			66.2%	49%	128bp	137bp	18%	295.9M	66.2%	49%	128bp	137bp	18%	295.9M
tih_rna_sample_00030_23KKJ7LT4_1	9999000000	306861921	151.8bp	142.0bp	0.70%	0.93%	0.69%	0.00%	1.57%	2.97%	0.95%	0.00%	592652144	0.01%	0.51%	289730956	0.62%	0.64%	0.36%	0.36%	178465496	90435329	105376553	51079972	357.39	163.00	0.72%	0.59%	0.98	0.000	No	0.00%				157bp	229bp	51.6%	0.0%	76.9%	85.9%	94.7%	280.7M	39.0%	98.1%	77681.7Mb	592.7M	52.7%	98.8%	49.2%
tih_rna_sample_00030_23KKJ7LT4_1_1																																	151.8bp	75.7%	224.4M																77.7%	52%	151bp	151bp	27%	516.8M
tih_rna_sample_00030_23KKJ7LT4_1_2																																																			76.0%	53%	151bp	151bp	18%	516.8M
tih_rna_sample_00030_23KKJ7LT4_1_trimmed_1																																																			71.8%	52%	134bp	151bp	27%	296.3M	71.8%	52%	134bp	151bp	27%	296.3M
tih_rna_sample_00030_23KKJ7LT4_1_trimmed_2																																																			70.9%	52%	134bp	151bp	18%	296.3M	70.9%	52%	134bp	151bp	18%	296.3M
tih_rna_sample_00032_23KKJ7LT4_1	9999000000	294514616	156.4bp	144.0bp	2.80%	1.10%	0.67%	0.00%	5.85%	3.27%	0.89%	0.00%	592897492	0.01%	0.52%	287065696	0.62%	0.65%	0.36%	0.35%	178546773	90701435	103346180	49785470	368.83	166.00	0.70%	0.58%	0.98	0.000	No	0.00%				164bp	248bp	52.0%	0.0%	77.2%	85.4%	94.7%	280.6M	38.9%	98.1%	78392.6Mb	592.9M	52.2%	98.8%	45.4%
tih_rna_sample_00032_23KKJ7LT4_1_1																																	156.4bp	76.5%	226.8M																77.5%	52%	151bp	151bp	27%	447.3M
tih_rna_sample_00032_23KKJ7LT4_1_2																																																			75.3%	52%	151bp	151bp	18%	447.3M
tih_rna_sample_00032_23KKJ7LT4_1_trimmed_1																																																			73.2%	51%	135bp	151bp	27%	296.4M	73.2%	51%	135bp	151bp	27%	296.4M
tih_rna_sample_00032_23KKJ7LT4_1_trimmed_2																																																			71.5%	52%	135bp	151bp	18%	296.4M	71.5%	52%	135bp	151bp	18%	296.4M
tih_rna_sample_00034_23KKJ7LT4_1	9999000000	201632589	130.7bp	125.0bp	0.71%	0.73%	0.45%	0.00%	1.41%	2.07%	0.66%	0.00%	543087540	0.04%	0.58%	225490387	0.51%	0.57%	0.40%	0.43%	116032314	58603933	90392838	44183700	197.03	45.00	0.56%	0.36%	0.98	0.000	No	0.00%				128bp	151bp	60.6%	0.0%	75.1%	62.3%	86.0%	233.5M	36.9%	97.1%	64831.1Mb	543.1M	61.3%	97.0%	68.0%
tih_rna_sample_00034_23KKJ7LT4_1_1																																	130.7bp	70.9%	192.5M																74.6%	59%	151bp	151bp	27%	279.8M
tih_rna_sample_00034_23KKJ7LT4_1_2																																																			72.5%	60%	151bp	151bp	27%	279.8M
tih_rna_sample_00034_23KKJ7LT4_1_trimmed_1																																																			74.2%	61%	123bp	127bp	18%	271.5M	74.2%	61%	123bp	127bp	18%	271.5M
tih_rna_sample_00034_23KKJ7LT4_1_trimmed_2																																																			73.4%	61%	123bp	127bp	9%	271.5M	73.4%	61%	123bp	127bp	9%	271.5M
tih_rna_sample_00035_23KKJ7LT4_1	9999000000	194250161	134.5bp	127.0bp	0.80%	0.94%	0.72%	0.00%	1.64%	2.81%	0.97%	0.00%	586945428	0.01%	0.61%	226420621	0.48%	0.50%	0.49%	0.50%	108380808	54737854	111231452	54701379	189.58	83.00	0.65%	0.46%	0.98	0.000	No	0.00%				132bp	167bp	62.1%	0.0%	72.7%	83.2%	94.1%	276.2M	42.8%	98.0%	71999.7Mb	586.9M	51.5%	97.8%	64.0%
tih_rna_sample_00035_23KKJ7LT4_1_1																																	134.5bp	71.7%	210.5M																74.5%	51%	151bp	151bp	27%	305.1M
tih_rna_sample_00035_23KKJ7LT4_1_2																																																			71.6%	52%	151bp	151bp	36%	305.1M
tih_rna_sample_00035_23KKJ7LT4_1_trimmed_1																																																			74.0%	51%	125bp	132bp	18%	293.5M	74.0%	51%	125bp	132bp	18%	293.5M
tih_rna_sample_00035_23KKJ7LT4_1_trimmed_2																																																			71.9%	51%	125bp	132bp	9%	293.5M	71.9%	51%	125bp	132bp	9%	293.5M
tih_rna_sample_00036_23KKJ7LT4_1	9999000000	143102222	121.8bp	118.0bp	1.23%	1.22%	0.57%	0.00%	2.77%	3.62%	0.77%	0.00%	454159590	0.02%	0.63%	167532462	0.30%	0.32%	0.64%	0.68%	50020494	25236437	107071118	53046655	74.93	30.00	0.51%	0.22%	0.98	0.000	No	0.00%				120bp	133bp	64.6%	0.0%	61.5%	72.7%	90.7%	206.0M	40.1%	97.7%	52754.3Mb	454.2M	52.8%	97.2%	75.1%
tih_rna_sample_00036_23KKJ7LT4_1_1																																	121.8bp	59.9%	136.0M																69.2%	53%	151bp	151bp	27%	233.6M
tih_rna_sample_00036_23KKJ7LT4_1_2																																																			67.5%	53%	151bp	151bp	36%	233.6M
tih_rna_sample_00036_23KKJ7LT4_1_trimmed_1																																																			68.7%	52%	119bp	122bp	18%	227.1M	68.7%	52%	119bp	122bp	18%	227.1M
tih_rna_sample_00036_23KKJ7LT4_1_trimmed_2																																																			67.8%	52%	119bp	122bp	9%	227.1M	67.8%	52%	119bp	122bp	9%	227.1M
tih_rna_sample_00037_23KKJ7LT4_1	9999000000	381620132	156.0bp	143.0bp	0.82%	0.94%	0.56%	0.00%	1.84%	3.04%	0.77%	0.00%	593321962	0.01%	0.45%	323458177	0.60%	0.62%	0.39%	0.38%	192923398	97905547	125222763	60699473	392.58	205.00	0.75%	0.62%	0.98	0.000	No	0.00%				157bp	219bp	45.9%	0.0%	73.1%	86.3%	94.8%	281.2M	35.0%	98.1%	77877.9Mb	593.3M	51.3%	98.9%	47.0%
tih_rna_sample_00037_23KKJ7LT4_1_1																																	156.0bp	72.7%	215.7M																77.9%	51%	151bp	151bp	27%	650.4M
tih_rna_sample_00037_23KKJ7LT4_1_2																																																			75.5%	51%	151bp	151bp	18%	650.4M
tih_rna_sample_00037_23KKJ7LT4_1_trimmed_1																																																			69.5%	51%	134bp	151bp	27%	296.7M	69.5%	51%	134bp	151bp	27%	296.7M
tih_rna_sample_00037_23KKJ7LT4_1_trimmed_2																																																			67.4%	51%	134bp	151bp	18%	296.7M	67.4%	51%	134bp	151bp	18%	296.7M
tih_rna_sample_00039_23KKJ7LT4_1	9999000000	258427730	137.2bp	128.0bp	3.51%	1.29%	0.74%	0.00%	7.24%	3.79%	0.96%	0.00%	590327930	0.01%	0.55%	268097194	0.53%	0.55%	0.44%	0.45%	141722676	71679019	118960461	58247192	259.30	127.00	0.69%	0.54%	0.98	0.000	No	0.00%				136bp	174bp	55.3%	0.0%	73.4%	80.2%	92.9%	274.1M	37.3%	98.0%	73356.0Mb	590.3M	52.0%	98.4%	61.2%
tih_rna_sample_00039_23KKJ7LT4_1_1																																	137.2bp	72.3%	213.4M																75.6%	51%	151bp	151bp	27%	410.9M
tih_rna_sample_00039_23KKJ7LT4_1_2																																																			72.8%	52%	151bp	151bp	18%	410.9M
tih_rna_sample_00039_23KKJ7LT4_1_trimmed_1																																																			71.7%	51%	127bp	137bp	27%	295.2M	71.7%	51%	127bp	137bp	27%	295.2M
tih_rna_sample_00039_23KKJ7LT4_1_trimmed_2																																																			69.5%	52%	127bp	137bp	18%	295.2M	69.5%	52%	127bp	137bp	18%	295.2M
tih_rna_sample_00041_23KKJ7LT4_1	9999000000	217497917	141.1bp	131.0bp	0.99%	0.66%	0.41%	0.00%	2.12%	2.03%	0.56%	0.00%	589346010	0.01%	0.58%	246854340	0.47%	0.49%	0.50%	0.51%	116032318	58827917	123646772	60628910	213.77	97.00	0.67%	0.49%	0.98	0.000	No	0.00%				140bp	178bp	58.8%	0.0%	67.9%	81.6%	93.5%	275.5M	41.0%	98.0%	74135.3Mb	589.3M	52.3%	98.2%	57.3%
tih_rna_sample_00041_23KKJ7LT4_1_1																																	141.1bp	67.1%	197.8M																76.1%	52%	151bp	151bp	27%	368.2M
tih_rna_sample_00041_23KKJ7LT4_1_2																																																			72.8%	52%	151bp	151bp	18%	368.2M
tih_rna_sample_00041_23KKJ7LT4_1_trimmed_1																																																			73.3%	52%	128bp	142bp	18%	294.7M	73.3%	52%	128bp	142bp	18%	294.7M
tih_rna_sample_00041_23KKJ7LT4_1_trimmed_2																																																			70.7%	52%	128bp	142bp	18%	294.7M	70.7%	52%	128bp	142bp	18%	294.7M
tih_rna_sample_00042_23KKJ7LT4_1	9999000000	275810878	137.6bp	129.0bp	2.30%	0.94%	0.56%	0.00%	5.02%	2.76%	0.74%	0.00%	554037268	0.01%	0.51%	271490089	0.52%	0.54%	0.46%	0.46%	140529174	71105054	125145966	61334876	257.52	123.00	0.70%	0.54%	0.98	0.000	No	0.00%				135bp	170bp	51.5%	0.0%	69.5%	82.3%	94.0%	260.4M	35.3%	98.0%	68738.2Mb	554.0M	51.3%	98.3%	60.6%
tih_rna_sample_00042_23KKJ7LT4_1_1																																	137.6bp	69.0%	191.0M																69.6%	51%	151bp	151bp	27%	281.9M
tih_rna_sample_00042_23KKJ7LT4_1_2																																																			67.0%	52%	151bp	151bp	18%	281.9M
tih_rna_sample_00042_23KKJ7LT4_1_trimmed_1																																																			69.4%	51%	127bp	137bp	18%	277.0M	69.4%	51%	127bp	137bp	18%	277.0M
tih_rna_sample_00042_23KKJ7LT4_1_trimmed_2																																																			67.4%	51%	127bp	137bp	9%	277.0M	67.4%	51%	127bp	137bp	9%	277.0M
tih_rna_sample_00043_23KKJ7LT4_1	9999000000	250195766	139.0bp	130.0bp	1.11%	0.73%	0.50%	0.00%	2.63%	2.44%	0.69%	0.00%	590919664	0.01%	0.55%	263243172	0.50%	0.52%	0.47%	0.48%	132928861	67302149	124516711	61043804	245.65	117.00	0.70%	0.53%	0.98	0.000	No	0.00%				141bp	188bp	56.0%	0.0%	70.5%	85.1%	94.8%	280.2M	38.5%	98.0%	73823.7Mb	590.9M	51.1%	98.5%	59.1%
tih_rna_sample_00043_23KKJ7LT4_1_1																																	139.0bp	70.0%	206.9M																75.5%	50%	151bp	151bp	27%	374.5M
tih_rna_sample_00043_23KKJ7LT4_1_2																																																			72.4%	51%	151bp	151bp	18%	374.5M
tih_rna_sample_00043_23KKJ7LT4_1_trimmed_1																																																			72.8%	50%	127bp	137bp	18%	295.5M	72.8%	50%	127bp	137bp	18%	295.5M
tih_rna_sample_00043_23KKJ7LT4_1_trimmed_2																																																			70.1%	51%	128bp	137bp	18%	295.5M	70.1%	51%	128bp	137bp	18%	295.5M
tih_rna_sample_00044_23KKJ7LT4_1	9999000000	282398819	136.1bp	128.0bp	0.56%	0.71%	0.55%	0.00%	1.24%	2.29%	0.77%	0.00%	590045030	0.01%	0.51%	287171432	0.58%	0.60%	0.40%	0.40%	166247354	84012399	114930795	56134471	307.16	162.00	0.72%	0.59%	0.98	0.000	No	0.00%				136bp	177bp	51.9%	0.0%	74.7%	84.7%	94.5%	278.9M	36.7%	97.8%	73076.8Mb	590.0M	52.2%	98.3%	61.5%
tih_rna_sample_00044_23KKJ7LT4_1_1																																	136.1bp	74.3%	219.3M																72.1%	52%	151bp	151bp	27%	318.0M
tih_rna_sample_00044_23KKJ7LT4_1_2																																																			70.3%	52%	151bp	151bp	18%	318.0M
tih_rna_sample_00044_23KKJ7LT4_1_trimmed_1																																																			71.2%	52%	127bp	137bp	18%	295.0M	71.2%	52%	127bp	137bp	18%	295.0M
tih_rna_sample_00044_23KKJ7LT4_1_trimmed_2																																																			70.1%	52%	127bp	137bp	9%	295.0M	70.1%	52%	127bp	137bp	9%	295.0M
tih_rna_sample_00045_23KKJ7LT4_1	9999000000	203471991	130.5bp	125.0bp	0.32%	0.62%	0.36%	0.00%	0.62%	1.84%	0.50%	0.00%	589430168	0.01%	0.63%	220523420	0.58%	0.61%	0.39%	0.39%	127904697	64546013	85351420	41692625	224.35	99.00	0.69%	0.50%	0.98	0.000	No	0.00%				135bp	190bp	63.4%	0.0%	81.3%	79.0%	92.5%	272.5M	43.0%	97.5%	71263.6Mb	589.4M	56.6%	98.2%	66.9%
tih_rna_sample_00045_23KKJ7LT4_1_1																																	130.5bp	80.0%	235.6M																76.5%	55%	151bp	151bp	27%	329.0M
tih_rna_sample_00045_23KKJ7LT4_1_2																																																			75.0%	56%	151bp	151bp	27%	329.0M
tih_rna_sample_00045_23KKJ7LT4_1_trimmed_1																																																			75.5%	56%	124bp	132bp	18%	294.7M	75.5%	56%	124bp	132bp	18%	294.7M
tih_rna_sample_00045_23KKJ7LT4_1_trimmed_2																																																			74.6%	56%	124bp	132bp	9%	294.7M	74.6%	56%	124bp	132bp	9%	294.7M
tih_rna_sample_00046_23KKJ7LT4_1	9999000000	249161662	128.0bp	122.0bp	0.65%	0.82%	0.45%	0.00%	1.46%	2.66%	0.66%	0.00%	590433368	0.01%	0.56%	258694643	0.54%	0.56%	0.44%	0.44%	138838153	70076883	114126938	55998599	243.63	121.00	0.71%	0.54%	0.98	0.000	No	0.00%				133bp	181bp	56.7%	0.0%	74.8%	84.2%	94.4%	278.7M	38.4%	97.8%	71401.5Mb	590.4M	52.1%	98.4%	66.9%
tih_rna_sample_00046_23KKJ7LT4_1_1																																	128.0bp	74.3%	219.3M																72.0%	51%	151bp	151bp	27%	315.8M
tih_rna_sample_00046_23KKJ7LT4_1_2																																																			70.1%	52%	151bp	151bp	18%	315.8M
tih_rna_sample_00046_23KKJ7LT4_1_trimmed_1																																																			71.2%	51%	124bp	132bp	18%	295.2M	71.2%	51%	124bp	132bp	18%	295.2M
tih_rna_sample_00046_23KKJ7LT4_1_trimmed_2																																																			70.0%	52%	124bp	132bp	9%	295.2M	70.0%	52%	124bp	132bp	9%	295.2M
tih_rna_sample_00047_23KKJ7LT4_1	9999000000	305427081	132.9bp	125.0bp	0.79%	1.31%	0.51%	0.00%	1.72%	3.88%	0.74%	0.00%	590845920	0.01%	0.51%	287721914	0.64%	0.66%	0.35%	0.34%	182980163	92428686	99579734	48403407	332.66	134.00	0.70%	0.55%	0.98	0.000	No	0.00%				133bp	174bp	51.8%	0.0%	79.8%	80.7%	93.3%	275.7M	34.6%	97.7%	72152.5Mb	590.8M	52.8%	98.5%	64.1%
tih_rna_sample_00047_23KKJ7LT4_1_1																																	132.9bp	78.9%	233.2M																75.6%	52%	151bp	151bp	27%	413.2M
tih_rna_sample_00047_23KKJ7LT4_1_2																																																			73.9%	53%	151bp	151bp	18%	413.2M
tih_rna_sample_00047_23KKJ7LT4_1_trimmed_1																																																			72.0%	52%	125bp	132bp	18%	295.4M	72.0%	52%	125bp	132bp	18%	295.4M
tih_rna_sample_00047_23KKJ7LT4_1_trimmed_2																																																			70.9%	52%	125bp	132bp	9%	295.4M	70.9%	52%	125bp	132bp	9%	295.4M
tih_rna_sample_00048_23KKJ7LT4_1	9999000000	212998512	127.2bp	120.0bp	0.74%	0.76%	0.53%	0.00%	1.53%	2.35%	0.74%	0.00%	588055630	0.01%	0.60%	235842282	0.56%	0.58%	0.42%	0.42%	131125262	66170986	98620934	48346542	223.21	106.00	0.68%	0.51%	0.98	0.000	No	0.00%				127bp	164bp	60.5%	0.0%	78.1%	81.1%	93.7%	275.4M	40.9%	97.7%	69714.2Mb	588.1M	53.2%	98.0%	69.5%
tih_rna_sample_00048_23KKJ7LT4_1_1																																	127.2bp	77.2%	227.1M																75.9%	52%	151bp	151bp	27%	344.4M
tih_rna_sample_00048_23KKJ7LT4_1_2																																																			73.6%	53%	151bp	151bp	27%	344.4M
tih_rna_sample_00048_23KKJ7LT4_1_trimmed_1																																																			74.0%	53%	121bp	127bp	18%	294.0M	74.0%	53%	121bp	127bp	18%	294.0M
tih_rna_sample_00048_23KKJ7LT4_1_trimmed_2																																																			72.3%	53%	121bp	127bp	9%	294.0M	72.3%	53%	121bp	127bp	9%	294.0M
tih_rna_sample_00050_23KKJ7LT4_1	9999000000	316639145	132.1bp	125.0bp	1.40%	1.58%	0.79%	0.00%	2.88%	4.37%	1.02%	0.00%	591348970	0.01%	0.50%	292865969	0.67%	0.69%	0.31%	0.31%	196702061	99306986	90375736	43760048	354.45	149.00	0.69%	0.56%	0.98	0.000	No	0.00%				134bp	189bp	51.0%	0.0%	82.4%	83.0%	93.8%	277.4M	34.9%	97.8%	72423.8Mb	591.3M	53.4%	98.6%	64.8%
tih_rna_sample_00050_23KKJ7LT4_1_1																																	132.1bp	81.7%	241.4M																76.1%	52%	151bp	151bp	27%	372.1M
tih_rna_sample_00050_23KKJ7LT4_1_2																																																			74.5%	53%	151bp	151bp	18%	372.1M
tih_rna_sample_00050_23KKJ7LT4_1_trimmed_1																																																			73.7%	53%	125bp	132bp	18%	295.7M	73.7%	53%	125bp	132bp	18%	295.7M
tih_rna_sample_00050_23KKJ7LT4_1_trimmed_2																																																			72.8%	53%	125bp	132bp	9%	295.7M	72.8%	53%	125bp	132bp	9%	295.7M
tih_rna_sample_00051_23KKJ7LT4_1	9999000000	337993135	147.4bp	138.0bp	1.20%	0.97%	0.57%	0.00%	2.61%	3.02%	0.82%	0.00%	592455498	0.01%	0.48%	305254326	0.68%	0.71%	0.30%	0.29%	208474900	105533380	91069826	43733989	414.46	187.00	0.71%	0.60%	0.98	0.000	No	0.00%				153bp	231bp	48.9%	0.0%	81.7%	84.2%	94.2%	279.1M	33.3%	97.7%	76421.7Mb	592.5M	53.1%	98.7%	52.7%
tih_rna_sample_00051_23KKJ7LT4_1_1																																	147.4bp	81.0%	240.1M																75.5%	52%	151bp	151bp	27%	390.5M
tih_rna_sample_00051_23KKJ7LT4_1_2																																																			74.4%	53%	151bp	151bp	18%	390.5M
tih_rna_sample_00051_23KKJ7LT4_1_trimmed_1																																																			72.7%	52%	132bp	147bp	18%	296.2M	72.7%	52%	132bp	147bp	18%	296.2M
tih_rna_sample_00051_23KKJ7LT4_1_trimmed_2																																																			72.2%	53%	132bp	147bp	9%	296.2M	72.2%	53%	132bp	147bp	9%	296.2M
tih_rna_sample_00052_23KKJ7LT4_1	9999000000	344758942	149.5bp	139.0bp	1.00%	1.18%	0.73%	0.00%	2.17%	3.48%	1.00%	0.00%	592933210	0.01%	0.49%	301203142	0.73%	0.76%	0.25%	0.24%	221055848	111956020	74459488	35283573	448.59	185.00	0.71%	0.59%	0.98	0.000	No	0.00%				160bp	267bp	49.7%	0.0%	86.1%	83.6%	93.7%	277.7M	37.0%	97.7%	77111.7Mb	592.9M	55.6%	98.8%	50.7%
tih_rna_sample_00052_23KKJ7LT4_1_1																																	149.5bp	85.3%	252.9M																80.9%	54%	151bp	151bp	27%	472.2M
tih_rna_sample_00052_23KKJ7LT4_1_2																																																			79.2%	55%	151bp	151bp	18%	472.2M
tih_rna_sample_00052_23KKJ7LT4_1_trimmed_1																																																			77.0%	55%	133bp	147bp	18%	296.5M	77.0%	55%	133bp	147bp	18%	296.5M
tih_rna_sample_00052_23KKJ7LT4_1_trimmed_2																																																			75.8%	55%	133bp	147bp	9%	296.5M	75.8%	55%	133bp	147bp	9%	296.5M
tih_rna_sample_00053_23KKJ7LT4_1	9999000000	94925075	109.1bp	106.0bp	1.40%	1.06%	0.90%	0.00%	2.98%	3.03%	1.15%	0.00%	325579848	0.03%	0.66%	109709208	0.33%	0.36%	0.59%	0.64%	36666778	18434824	64785159	32099087	49.96	18.00	0.40%	0.13%	0.98	0.000	No	0.00%				108bp	123bp	68.0%	0.0%	70.6%	73.5%	90.6%	147.5M	37.3%	97.7%	34634.2Mb	325.6M	50.3%	95.5%	83.9%
tih_rna_sample_00053_23KKJ7LT4_1_1																																	109.1bp	68.8%	111.9M																72.7%	51%	151bp	151bp	36%	170.5M
tih_rna_sample_00053_23KKJ7LT4_1_2																																																			70.9%	53%	151bp	151bp	36%	170.5M
tih_rna_sample_00053_23KKJ7LT4_1_trimmed_1																																																			71.8%	50%	109bp	112bp	18%	162.8M	71.8%	50%	109bp	112bp	18%	162.8M
tih_rna_sample_00053_23KKJ7LT4_1_trimmed_2																																																			70.7%	50%	109bp	112bp	9%	162.8M	70.7%	50%	109bp	112bp	9%	162.8M
tih_rna_sample_00054_23KKJ7LT4_1	9999000000	44383772	115.1bp	112.0bp	0.29%	0.70%	0.30%	0.00%	0.70%	2.23%	0.42%	0.00%	129898092	0.03%	0.62%	49705457	0.24%	0.26%	0.69%	0.74%	11749827	5919915	34533896	17140971	16.41	7.00	0.15%	0.02%	0.98	0.000	No	0.00%				113bp	121bp	63.4%	0.0%	57.9%	70.5%	90.0%	58.4M	43.5%	97.5%	14279.4Mb	129.9M	52.1%	89.1%	78.0%
tih_rna_sample_00054_23KKJ7LT4_1_1																																	115.1bp	56.9%	36.9M																68.5%	55%	151bp	151bp	45%	72.9M
tih_rna_sample_00054_23KKJ7LT4_1_2																																																			66.2%	57%	151bp	151bp	45%	72.9M
tih_rna_sample_00054_23KKJ7LT4_1_trimmed_1																																																			64.8%	51%	113bp	112bp	18%	64.9M	64.8%	51%	113bp	112bp	18%	64.9M
tih_rna_sample_00054_23KKJ7LT4_1_trimmed_2																																																			63.2%	52%	113bp	117bp	9%	64.9M	63.2%	52%	113bp	117bp	9%	64.9M
tih_rna_sample_00056_23KKJ7LT4_1	9999000000	283853997	141.3bp	133.0bp	0.40%	1.33%	0.58%	0.00%	0.87%	4.05%	0.82%	0.00%	545906122	0.01%	0.49%	280654321	0.56%	0.57%	0.43%	0.43%	155819245	78859395	119345302	58309234	294.72	151.00	0.72%	0.58%	0.98	0.000	No	0.00%				141bp	178bp	49.1%	0.0%	71.0%	82.4%	93.8%	256.1M	36.2%	97.8%	68943.8Mb	545.9M	51.3%	98.6%	57.4%
tih_rna_sample_00056_23KKJ7LT4_1_1																																	141.3bp	70.7%	192.9M																69.0%	51%	151bp	151bp	27%	276.8M
tih_rna_sample_00056_23KKJ7LT4_1_2																																																			67.2%	51%	151bp	151bp	18%	276.8M
tih_rna_sample_00056_23KKJ7LT4_1_trimmed_1																																																			68.9%	51%	129bp	142bp	18%	273.0M	68.9%	51%	129bp	142bp	18%	273.0M
tih_rna_sample_00056_23KKJ7LT4_1_trimmed_2																																																			67.8%	51%	129bp	142bp	9%	273.0M	67.8%	51%	129bp	142bp	9%	273.0M
tih_rna_sample_00057_23KKJ7LT4_1	9999000000	21683868	127.5bp	123.0bp	0.26%	0.72%	0.31%	0.00%	0.59%	2.23%	0.47%	0.00%	78700670	0.04%	0.67%	26061635	0.29%	0.34%	0.57%	0.66%	7685076	3874622	14983687	7400283	12.03	4.00	0.09%	0.01%	0.98	0.000	No	0.00%				124bp	142bp	69.9%	0.0%	69.0%	62.2%	86.1%	33.9M	52.0%	97.1%	9236.5Mb	78.7M	57.0%	86.5%	68.3%
tih_rna_sample_00057_23KKJ7LT4_1_1																																	127.5bp	64.6%	25.4M																74.3%	58%	151bp	151bp	45%	45.5M
tih_rna_sample_00057_23KKJ7LT4_1_2																																																			72.6%	61%	151bp	151bp	45%	45.5M
tih_rna_sample_00057_23KKJ7LT4_1_trimmed_1																																																			70.6%	56%	121bp	127bp	18%	39.4M	70.6%	56%	121bp	127bp	18%	39.4M
tih_rna_sample_00057_23KKJ7LT4_1_trimmed_2																																																			69.7%	57%	121bp	127bp	9%	39.4M	69.7%	57%	121bp	127bp	9%	39.4M
tih_rna_sample_00058_23KKJ7LT4_1	9999000000	205071268	145.6bp	136.0bp	1.31%	0.60%	0.44%	0.00%	2.91%	1.88%	0.61%	0.00%	590960924	0.02%	0.59%	239397450	0.56%	0.60%	0.40%	0.40%	133480101	67775051	95120437	46122745	257.22	121.00	0.69%	0.54%	0.98	0.000	No	0.00%				148bp	205bp	60.6%	0.0%	77.6%	81.6%	93.0%	274.7M	45.4%	97.7%	75475.3Mb	591.0M	53.8%	98.5%	54.3%
tih_rna_sample_00058_23KKJ7LT4_1_1																																	145.6bp	76.0%	224.5M																76.1%	53%	151bp	151bp	27%	305.0M
tih_rna_sample_00058_23KKJ7LT4_1_2																																																			73.7%	54%	151bp	151bp	18%	305.0M
tih_rna_sample_00058_23KKJ7LT4_1_trimmed_1																																																			75.9%	53%	131bp	142bp	18%	295.5M	75.9%	53%	131bp	142bp	18%	295.5M
tih_rna_sample_00058_23KKJ7LT4_1_trimmed_2																																																			74.1%	54%	131bp	147bp	9%	295.5M	74.1%	54%	131bp	147bp	9%	295.5M
tih_rna_sample_00060_23KKJ7LT4_1	9999000000	208738212	125.3bp	120.0bp	0.41%	0.61%	0.35%	0.00%	0.94%	1.95%	0.47%	0.00%	443527694	0.01%	0.53%	208448135	0.42%	0.44%	0.55%	0.56%	87515878	44134497	115228238	56918933	144.17	75.00	0.66%	0.43%	0.98	0.000	No	0.00%				123bp	141bp	53.7%	0.0%	65.6%	80.0%	93.3%	206.9M	36.7%	97.7%	52089.9Mb	443.5M	51.9%	97.4%	71.0%
tih_rna_sample_00060_23KKJ7LT4_1_1																																	125.3bp	65.4%	145.1M																67.6%	52%	151bp	151bp	27%	227.8M
tih_rna_sample_00060_23KKJ7LT4_1_2																																																			64.4%	52%	151bp	151bp	36%	227.8M
tih_rna_sample_00060_23KKJ7LT4_1_trimmed_1																																																			67.1%	51%	120bp	122bp	18%	221.8M	67.1%	51%	120bp	122bp	18%	221.8M
tih_rna_sample_00060_23KKJ7LT4_1_trimmed_2																																																			64.5%	52%	120bp	127bp	9%	221.8M	64.5%	52%	120bp	127bp	9%	221.8M
tih_rna_sample_00061_23KKJ7LT4_1	9999000000	293902552	140.0bp	133.0bp	0.84%	0.77%	0.62%	0.00%	1.84%	2.36%	0.86%	0.00%	590499994	0.01%	0.52%	283498390	0.67%	0.69%	0.31%	0.31%	189867925	95892914	87111573	42107486	359.31	165.00	0.73%	0.59%	0.98	0.000	No	0.00%				145bp	208bp	52.6%	0.0%	82.6%	84.3%	94.2%	278.0M	39.1%	97.7%	74940.3Mb	590.5M	55.8%	98.4%	58.1%
tih_rna_sample_00061_23KKJ7LT4_1_1																																	140.0bp	81.9%	241.8M																77.6%	55%	151bp	151bp	27%	386.8M
tih_rna_sample_00061_23KKJ7LT4_1_2																																																			75.7%	55%	151bp	151bp	18%	386.8M
tih_rna_sample_00061_23KKJ7LT4_1_trimmed_1																																																			75.0%	55%	130bp	142bp	18%	295.2M	75.0%	55%	130bp	142bp	18%	295.2M
tih_rna_sample_00061_23KKJ7LT4_1_trimmed_2																																																			73.7%	55%	130bp	142bp	9%	295.2M	73.7%	55%	130bp	142bp	9%	295.2M
tih_rna_sample_00063_23KKJ7LT4_1	9999000000	316658801	142.9bp	134.0bp	0.62%	0.89%	0.40%	0.00%	1.30%	2.60%	0.60%	0.00%	589795314	0.01%	0.50%	295107185	0.68%	0.71%	0.29%	0.29%	200983669	101732505	86656061	41540881	387.23	146.00	0.73%	0.57%	0.98	0.000	No	0.00%				146bp	201bp	50.6%	0.0%	82.0%	79.6%	92.9%	273.9M	37.8%	97.5%	74785.5Mb	589.8M	58.3%	98.3%	55.7%
tih_rna_sample_00063_23KKJ7LT4_1_1																																	142.9bp	80.9%	238.7M																78.7%	57%	151bp	151bp	27%	439.7M
tih_rna_sample_00063_23KKJ7LT4_1_2																																																			77.2%	57%	151bp	151bp	18%	439.7M
tih_rna_sample_00063_23KKJ7LT4_1_trimmed_1																																																			74.9%	58%	130bp	142bp	18%	294.9M	74.9%	58%	130bp	142bp	18%	294.9M
tih_rna_sample_00063_23KKJ7LT4_1_trimmed_2																																																			74.1%	58%	130bp	142bp	9%	294.9M	74.1%	58%	130bp	142bp	9%	294.9M
tih_rna_sample_00064_23KKJ7LT4_1	9999000000	365499780	148.0bp	139.0bp	1.38%	1.57%	0.55%	0.00%	2.63%	4.74%	0.78%	0.00%	593234792	0.01%	0.45%	323338155	0.68%	0.70%	0.31%	0.30%	219566413	111199850	99449253	47813331	440.46	222.00	0.74%	0.62%	0.98	0.000	No	0.00%				154bp	242bp	45.8%	0.0%	80.7%	86.6%	95.1%	282.0M	34.9%	97.8%	76702.2Mb	593.2M	51.9%	98.9%	51.7%
tih_rna_sample_00064_23KKJ7LT4_1_1																																	148.0bp	80.3%	238.1M																78.9%	51%	151bp	151bp	27%	556.0M
tih_rna_sample_00064_23KKJ7LT4_1_2																																																			77.2%	52%	151bp	151bp	18%	556.0M
tih_rna_sample_00064_23KKJ7LT4_1_trimmed_1																																																			72.6%	51%	132bp	147bp	18%	296.6M	72.6%	51%	132bp	147bp	18%	296.6M
tih_rna_sample_00064_23KKJ7LT4_1_trimmed_2																																																			71.4%	52%	132bp	147bp	9%	296.6M	71.4%	52%	132bp	147bp	9%	296.6M
tih_rna_sample_00066_23KKJ7LT4_1	9999000000	269123217	145.1bp	135.0bp	0.38%	0.79%	0.42%	0.00%	0.79%	2.34%	0.56%	0.00%	592849996	0.01%	0.55%	265881143	0.67%	0.69%	0.31%	0.31%	178122492	90150665	82974506	39941282	351.87	170.00	0.74%	0.60%	0.98	0.000	No	0.00%				155bp	269bp	55.6%	0.0%	82.9%	85.8%	94.4%	279.7M	41.2%	97.9%	75789.2Mb	592.8M	52.9%	98.8%	54.7%
tih_rna_sample_00066_23KKJ7LT4_1_1																																	145.1bp	82.3%	244.0M																78.1%	52%	151bp	151bp	27%	335.5M
tih_rna_sample_00066_23KKJ7LT4_1_2																																																			75.7%	53%	151bp	151bp	18%	335.5M
tih_rna_sample_00066_23KKJ7LT4_1_trimmed_1																																																			77.1%	52%	131bp	142bp	18%	296.4M	77.1%	52%	131bp	142bp	18%	296.4M
tih_rna_sample_00066_23KKJ7LT4_1_trimmed_2																																																			75.3%	53%	131bp	142bp	9%	296.4M	75.3%	53%	131bp	142bp	9%	296.4M
tih_rna_sample_00068_23KKJ7LT4_1	9999000000	297778368	136.6bp	128.0bp	1.01%	0.87%	0.49%	0.00%	2.20%	2.72%	0.67%	0.00%	589908834	0.01%	0.51%	290322198	0.59%	0.61%	0.39%	0.39%	170650845	86310335	114144183	55640277	318.58	156.00	0.72%	0.58%	0.98	0.000	No	0.00%				139bp	189bp	51.3%	0.0%	75.3%	84.9%	94.5%	278.9M	37.1%	97.8%	73327.4Mb	589.9M	51.8%	98.3%	59.9%
tih_rna_sample_00068_23KKJ7LT4_1_1																																	136.6bp	75.0%	221.3M																73.6%	51%	151bp	151bp	27%	342.7M
tih_rna_sample_00068_23KKJ7LT4_1_2																																																			71.1%	52%	151bp	151bp	18%	342.7M
tih_rna_sample_00068_23KKJ7LT4_1_trimmed_1																																																			71.9%	51%	127bp	137bp	18%	295.0M	71.9%	51%	127bp	137bp	18%	295.0M
tih_rna_sample_00068_23KKJ7LT4_1_trimmed_2																																																			69.9%	51%	127bp	137bp	9%	295.0M	69.9%	51%	127bp	137bp	9%	295.0M
tih_rna_sample_00070_23KKJ7LT4_1	9999000000	306760137	146.4bp	136.0bp	0.94%	0.71%	0.47%	0.00%	2.19%	2.20%	0.66%	0.00%	592675744	0.01%	0.50%	295452289	0.64%	0.67%	0.33%	0.33%	189758262	96192526	98825028	47640725	377.32	176.00	0.72%	0.59%	0.98	0.000	No	0.00%				154bp	237bp	50.7%	0.0%	79.4%	86.6%	94.9%	281.2M	38.2%	97.8%	76382.0Mb	592.7M	52.5%	98.8%	52.5%
tih_rna_sample_00070_23KKJ7LT4_1_1																																	146.4bp	78.6%	233.0M																76.7%	52%	151bp	151bp	27%	379.8M
tih_rna_sample_00070_23KKJ7LT4_1_2																																																			74.5%	52%	151bp	151bp	18%	379.8M
tih_rna_sample_00070_23KKJ7LT4_1_trimmed_1																																																			74.2%	52%	132bp	147bp	18%	296.3M	74.2%	52%	132bp	147bp	18%	296.3M
tih_rna_sample_00070_23KKJ7LT4_1_trimmed_2																																																			72.6%	52%	132bp	147bp	9%	296.3M	72.6%	52%	132bp	147bp	9%	296.3M
tih_rna_sample_00071_23KKJ7LT4_1	9999000000	154009948	131.3bp	126.0bp	0.30%	0.50%	0.41%	0.00%	0.68%	1.55%	0.68%	0.00%	584626416	0.02%	0.69%	180491401	0.51%	0.55%	0.42%	0.45%	91447167	46154916	75743554	37021287	153.20	38.00	0.54%	0.32%	0.97	0.000	No	0.00%				132bp	163bp	70.7%	0.0%	81.3%	70.7%	89.7%	262.1M	49.7%	97.0%	70580.1Mb	584.6M	61.8%	97.4%	67.2%
tih_rna_sample_00071_23KKJ7LT4_1_1																																	131.3bp	78.8%	230.3M																81.9%	60%	151bp	151bp	27%	422.5M
tih_rna_sample_00071_23KKJ7LT4_1_2																																																			79.9%	60%	151bp	151bp	27%	422.5M
tih_rna_sample_00071_23KKJ7LT4_1_trimmed_1																																																			78.5%	61%	124bp	132bp	18%	292.3M	78.5%	61%	124bp	132bp	18%	292.3M
tih_rna_sample_00071_23KKJ7LT4_1_trimmed_2																																																			77.4%	62%	125bp	132bp	9%	292.3M	77.4%	62%	125bp	132bp	9%	292.3M
tih_rna_sample_00072_23KKJ7LT4_1	9999000000	329894082	137.0bp	127.0bp	1.74%	1.12%	0.75%	0.00%	3.62%	3.29%	1.00%	0.00%	592577414	0.01%	0.49%	301302600	0.66%	0.68%	0.32%	0.32%	200289201	101283686	96448945	46616908	379.88	192.00	0.74%	0.61%	0.98	0.000	Yes	0.12%				140bp	212bp	49.5%	0.0%	81.0%	85.9%	94.9%	281.1M	35.5%	97.8%	73507.5Mb	592.6M	52.0%	98.8%	60.1%
tih_rna_sample_00072_23KKJ7LT4_1_1																																	137.0bp	80.4%	238.2M																78.7%	52%	151bp	151bp	27%	452.3M
tih_rna_sample_00072_23KKJ7LT4_1_2																																																			76.1%	52%	151bp	151bp	18%	452.3M
tih_rna_sample_00072_23KKJ7LT4_1_trimmed_1																																																			74.6%	51%	127bp	137bp	18%	296.3M	74.6%	51%	127bp	137bp	18%	296.3M
tih_rna_sample_00072_23KKJ7LT4_1_trimmed_2																																																			72.4%	52%	127bp	137bp	9%	296.3M	72.4%	52%	127bp	137bp	9%	296.3M
tih_rna_sample_00073_23KKJ7LT4_1	9999000000	248886946	126.2bp	120.0bp	0.65%	1.14%	0.49%	0.00%	1.47%	3.45%	0.67%	0.00%	536722954	0.01%	0.52%	259595729	0.48%	0.49%	0.50%	0.51%	123484034	62315207	129804564	63968196	207.98	102.00	0.68%	0.51%	0.98	0.000	No	0.00%				125bp	148bp	52.2%	0.0%	67.9%	82.8%	94.0%	252.3M	35.4%	97.8%	63693.9Mb	536.7M	49.3%	98.4%	70.2%
tih_rna_sample_00073_23KKJ7LT4_1_1																																	126.2bp	67.3%	180.6M																69.4%	49%	151bp	151bp	27%	272.6M
tih_rna_sample_00073_23KKJ7LT4_1_2																																																			66.2%	50%	151bp	151bp	27%	272.6M
tih_rna_sample_00073_23KKJ7LT4_1_trimmed_1																																																			69.2%	49%	121bp	127bp	18%	268.4M	69.2%	49%	121bp	127bp	18%	268.4M
tih_rna_sample_00073_23KKJ7LT4_1_trimmed_2																																																			66.7%	49%	121bp	127bp	18%	268.4M	66.7%	49%	121bp	127bp	18%	268.4M
tih_rna_sample_00074_23KKJ7LT4_1	9999000000	251217659	130.3bp	122.0bp	0.45%	1.20%	1.28%	0.00%	0.89%	3.40%	1.64%	0.00%	590309544	0.01%	0.58%	250075227	0.72%	0.75%	0.26%	0.25%	180936256	91291782	64742777	31082661	323.33	98.00	0.62%	0.50%	0.98	0.000	No	0.00%				133bp	215bp	58.1%	0.0%	89.1%	86.3%	95.0%	280.4M	38.4%	97.7%	71194.1Mb	590.3M	54.3%	98.4%	67.3%
tih_rna_sample_00074_23KKJ7LT4_1_1																																	130.3bp	88.0%	259.6M																84.2%	53%	151bp	151bp	27%	587.3M
tih_rna_sample_00074_23KKJ7LT4_1_2																																																			82.4%	54%	151bp	151bp	18%	587.3M
tih_rna_sample_00074_23KKJ7LT4_1_trimmed_1																																																			78.4%	54%	123bp	127bp	18%	295.2M	78.4%	54%	123bp	127bp	18%	295.2M
tih_rna_sample_00074_23KKJ7LT4_1_trimmed_2																																																			77.3%	54%	123bp	127bp	9%	295.2M	77.3%	54%	123bp	127bp	9%	295.2M
tih_rna_sample_00077_23KKJ7LT4_1	9999000000	214472278	133.7bp	126.0bp	0.61%	0.59%	0.43%	0.00%	1.30%	1.78%	0.64%	0.00%	585536320	0.02%	0.60%	231968880	0.58%	0.63%	0.36%	0.37%	135694457	68513425	84115419	40911910	240.54	78.00	0.65%	0.46%	0.98	0.000	No	0.00%				131bp	166bp	61.7%	0.0%	80.5%	70.1%	88.8%	260.1M	42.7%	97.2%	70905.9Mb	585.5M	59.9%	97.6%	64.6%
tih_rna_sample_00077_23KKJ7LT4_1_1																																	133.7bp	78.3%	229.2M																78.2%	58%	151bp	151bp	27%	324.3M
tih_rna_sample_00077_23KKJ7LT4_1_2																																																			75.8%	59%	151bp	151bp	18%	324.3M
tih_rna_sample_00077_23KKJ7LT4_1_trimmed_1																																																			77.3%	59%	124bp	132bp	18%	292.8M	77.3%	59%	124bp	132bp	18%	292.8M
tih_rna_sample_00077_23KKJ7LT4_1_trimmed_2																																																			76.0%	60%	125bp	132bp	9%	292.8M	76.0%	60%	125bp	132bp	9%	292.8M
tih_rna_sample_00078_23KKJ7LT4_1	9999000000	291679893	142.9bp	132.0bp	1.07%	0.87%	0.43%	0.00%	2.36%	2.62%	0.58%	0.00%	591913175	0.01%	0.52%	281607324	0.64%	0.66%	0.34%	0.34%	181076744	91733230	96005335	46367732	351.06	183.00	0.74%	0.61%	0.98	0.000	No	0.00%				143bp	211bp	52.8%	0.0%	80.3%	86.2%	95.1%	281.5M	38.7%	97.9%	74690.0Mb	591.9M	52.0%	98.7%	56.2%
tih_rna_sample_00078_23KKJ7LT4_1_1																																	142.9bp	79.7%	235.9M																79.0%	51%	151bp	151bp	27%	435.0M
tih_rna_sample_00078_23KKJ7LT4_1_2																																																			75.8%	52%	151bp	151bp	18%	435.0M
tih_rna_sample_00078_23KKJ7LT4_1_trimmed_1																																																			75.2%	51%	129bp	142bp	18%	296.0M	75.2%	51%	129bp	142bp	18%	296.0M
tih_rna_sample_00078_23KKJ7LT4_1_trimmed_2																																																			72.2%	52%	129bp	142bp	9%	296.0M	72.2%	52%	129bp	142bp	9%	296.0M
tih_rna_sample_00079_23KKJ7LT4_1	9999000000	98410822	137.6bp	130.0bp	1.70%	0.51%	0.32%	0.00%	3.54%	1.57%	0.51%	0.00%	447264752	0.03%	0.73%	120872346	0.45%	0.52%	0.43%	0.48%	54668367	27631725	52100419	25411193	95.13	31.00	0.51%	0.25%	0.97	0.000	No	0.00%				133bp	163bp	75.4%	0.0%	78.0%	55.5%	83.3%	186.4M	52.4%	96.6%	54519.9Mb	447.3M	61.3%	95.4%	61.6%
tih_rna_sample_00079_23KKJ7LT4_1_1																																	137.6bp	74.4%	166.3M																82.3%	59%	151bp	151bp	27%	234.5M
tih_rna_sample_00079_23KKJ7LT4_1_2																																																			79.4%	61%	151bp	151bp	36%	234.5M
tih_rna_sample_00079_23KKJ7LT4_1_trimmed_1																																																			82.0%	61%	126bp	132bp	18%	223.6M	82.0%	61%	126bp	132bp	18%	223.6M
tih_rna_sample_00079_23KKJ7LT4_1_trimmed_2																																																			80.5%	61%	127bp	137bp	9%	223.6M	80.5%	61%	127bp	137bp	9%	223.6M
tih_rna_sample_00080_23KKJ7LT4_1	9999000000	186783978	119.2bp	113.0bp	0.45%	0.54%	0.38%	0.00%	1.02%	1.74%	0.55%	0.00%	489940966	0.02%	0.59%	198758969	0.43%	0.46%	0.53%	0.54%	86048124	43351848	104896493	51795973	135.52	63.00	0.63%	0.39%	0.98	0.000	No	0.00%				117bp	141bp	60.4%	0.0%	70.4%	75.7%	92.0%	225.3M	37.9%	97.5%	55452.4Mb	489.9M	53.9%	97.3%	75.4%
tih_rna_sample_00080_23KKJ7LT4_1_1																																	119.2bp	69.3%	169.9M																70.7%	53%	151bp	151bp	36%	251.7M
tih_rna_sample_00080_23KKJ7LT4_1_2																																																			68.3%	54%	151bp	151bp	27%	251.7M
tih_rna_sample_00080_23KKJ7LT4_1_trimmed_1																																																			70.3%	53%	116bp	117bp	18%	245.0M	70.3%	53%	116bp	117bp	18%	245.0M
tih_rna_sample_00080_23KKJ7LT4_1_trimmed_2																																																			68.6%	54%	116bp	117bp	9%	245.0M	68.6%	54%	116bp	117bp	9%	245.0M
tih_rna_sample_00081_23KKJ7LT4_1	9999000000	306452669	135.3bp	127.0bp	0.38%	0.61%	0.55%	0.00%	0.85%	1.99%	0.80%	0.00%	592174830	0.01%	0.51%	290474760	0.67%	0.69%	0.31%	0.31%	194402407	98253175	90346117	43695126	357.59	166.00	0.73%	0.59%	0.98	0.000	No	0.00%				137bp	200bp	51.4%	0.0%	82.1%	85.0%	94.7%	280.3M	36.1%	97.7%	72603.7Mb	592.2M	54.3%	98.7%	62.7%
tih_rna_sample_00081_23KKJ7LT4_1_1																																	135.3bp	81.3%	240.9M																76.7%	53%	151bp	151bp	27%	359.1M
tih_rna_sample_00081_23KKJ7LT4_1_2																																																			74.4%	54%	151bp	151bp	18%	359.1M
tih_rna_sample_00081_23KKJ7LT4_1_trimmed_1																																																			74.8%	54%	125bp	132bp	18%	296.1M	74.8%	54%	125bp	132bp	18%	296.1M
tih_rna_sample_00081_23KKJ7LT4_1_trimmed_2																																																			73.0%	54%	125bp	132bp	9%	296.1M	73.0%	54%	125bp	132bp	9%	296.1M
tih_rna_sample_00082_23KKJ7LT4_1	9999000000	274962836	133.5bp	124.0bp	1.69%	1.33%	0.52%	0.00%	3.59%	3.81%	0.70%	0.00%	591084370	0.01%	0.53%	278553889	0.62%	0.64%	0.36%	0.36%	173411971	87648230	100200884	48709012	315.81	141.00	0.67%	0.55%	0.98	0.000	No	0.00%				134bp	188bp	53.3%	0.0%	79.6%	83.9%	94.4%	278.9M	37.1%	97.8%	72365.2Mb	591.1M	52.1%	98.5%	63.6%
tih_rna_sample_00082_23KKJ7LT4_1_1																																	133.5bp	79.0%	233.4M																77.0%	52%	151bp	151bp	27%	377.9M
tih_rna_sample_00082_23KKJ7LT4_1_2																																																			74.7%	52%	151bp	151bp	18%	377.9M
tih_rna_sample_00082_23KKJ7LT4_1_trimmed_1																																																			74.5%	51%	125bp	132bp	18%	295.5M	74.5%	51%	125bp	132bp	18%	295.5M
tih_rna_sample_00082_23KKJ7LT4_1_trimmed_2																																																			72.8%	52%	125bp	132bp	9%	295.5M	72.8%	52%	125bp	132bp	9%	295.5M
tih_rna_sample_00083_23KKJ7LT4_1	9999000000	215953928	138.7bp	129.0bp	0.77%	1.26%	0.74%	0.00%	1.41%	3.72%	1.00%	0.00%	587724570	0.01%	0.59%	240520631	0.61%	0.63%	0.37%	0.37%	146673347	74224070	88726601	43046491	270.26	122.00	0.67%	0.53%	0.98	0.000	No	0.00%				139bp	200bp	59.6%	0.0%	80.4%	83.4%	94.4%	277.5M	43.4%	97.8%	72974.7Mb	587.7M	53.2%	98.0%	60.1%
tih_rna_sample_00083_23KKJ7LT4_1_1																																	138.7bp	79.9%	234.7M																77.7%	52%	151bp	151bp	27%	331.2M
tih_rna_sample_00083_23KKJ7LT4_1_2																																																			75.4%	54%	151bp	151bp	27%	331.2M
tih_rna_sample_00083_23KKJ7LT4_1_trimmed_1																																																			76.5%	53%	127bp	137bp	18%	293.9M	76.5%	53%	127bp	137bp	18%	293.9M
tih_rna_sample_00083_23KKJ7LT4_1_trimmed_2																																																			74.9%	53%	127bp	137bp	9%	293.9M	74.9%	53%	127bp	137bp	9%	293.9M
tih_rna_sample_00084_23KKJ7LT4_1	9999000000	116933697	109.2bp	106.0bp	0.85%	0.70%	0.34%	0.00%	1.95%	2.21%	0.48%	0.00%	341340348	0.02%	0.63%	126209596	0.29%	0.30%	0.67%	0.70%	36051245	18137810	84066276	41713829	49.10	21.00	0.42%	0.13%	0.98	0.000	No	0.00%				108bp	118bp	64.2%	0.0%	63.9%	71.3%	90.6%	154.6M	37.1%	97.6%	36431.7Mb	341.3M	52.3%	96.8%	83.9%
tih_rna_sample_00084_23KKJ7LT4_1_1																																	109.2bp	63.1%	107.7M																69.9%	53%	151bp	151bp	36%	176.3M
tih_rna_sample_00084_23KKJ7LT4_1_2																																																			67.4%	53%	151bp	151bp	36%	176.3M
tih_rna_sample_00084_23KKJ7LT4_1_trimmed_1																																																			69.3%	52%	109bp	107bp	18%	170.7M	69.3%	52%	109bp	107bp	18%	170.7M
tih_rna_sample_00084_23KKJ7LT4_1_trimmed_2																																																			67.4%	52%	110bp	107bp	9%	170.7M	67.4%	52%	110bp	107bp	9%	170.7M
tih_rna_sample_00086_23KKJ7LT4_1	9999000000	249243249	136.1bp	127.0bp	1.95%	0.95%	0.33%	0.00%	4.48%	2.95%	0.49%	0.00%	589851950	0.01%	0.57%	256385616	0.64%	0.67%	0.33%	0.33%	163288223	82559387	85062833	41142031	302.10	127.00	0.70%	0.55%	0.98	0.000	No	0.00%				139bp	199bp	57.3%	0.0%	82.2%	80.7%	93.2%	274.7M	40.4%	97.6%	72843.6Mb	589.9M	56.0%	98.3%	61.3%
tih_rna_sample_00086_23KKJ7LT4_1_1																																	136.1bp	80.8%	238.3M																78.8%	55%	151bp	151bp	36%	400.8M
tih_rna_sample_00086_23KKJ7LT4_1_2																																																			76.6%	56%	151bp	151bp	18%	400.8M
tih_rna_sample_00086_23KKJ7LT4_1_trimmed_1																																																			75.7%	55%	126bp	137bp	27%	294.9M	75.7%	55%	126bp	137bp	27%	294.9M
tih_rna_sample_00086_23KKJ7LT4_1_trimmed_2																																																			74.4%	56%	127bp	137bp	18%	294.9M	74.4%	56%	127bp	137bp	18%	294.9M
tih_rna_sample_00170_23KKJ7LT4_1	9999000000	295053363	125.8bp	120.0bp	0.56%	0.89%	0.45%	0.00%	1.26%	2.75%	0.60%	0.00%	566099764	0.01%	0.47%	301040204	0.37%	0.38%	0.61%	0.62%	112130787	56658352	183195036	90685574	183.09	99.00	0.69%	0.50%	0.98	0.000	No	0.00%				124bp	137bp	47.3%	0.0%	53.0%	82.8%	94.0%	266.0M	30.1%	98.2%	66879.9Mb	566.1M	48.0%	98.8%	70.5%
tih_rna_sample_00170_23KKJ7LT4_1_1																																	125.8bp	53.6%	151.6M																62.0%	48%	151bp	151bp	27%	286.6M
tih_rna_sample_00170_23KKJ7LT4_1_2																																																			58.3%	49%	151bp	151bp	27%	286.6M
tih_rna_sample_00170_23KKJ7LT4_1_trimmed_1																																																			61.9%	47%	120bp	127bp	27%	283.0M	61.9%	47%	120bp	127bp	27%	283.0M
tih_rna_sample_00170_23KKJ7LT4_1_trimmed_2																																																			58.5%	48%	120bp	127bp	18%	283.0M	58.5%	48%	120bp	127bp	18%	283.0M
tih_rna_sample_00176_23KKJ7LT4_1	9999000000	110030571	131.8bp	126.0bp	0.84%	0.48%	0.33%	0.00%	1.83%	1.48%	0.51%	0.00%	499625472	0.02%	0.72%	139720473	0.38%	0.43%	0.53%	0.57%	53619125	27079631	74306802	36581984	89.00	22.00	0.44%	0.20%	0.98	0.000	No	0.00%				131bp	154bp	73.8%	0.0%	72.8%	63.3%	87.1%	217.6M	47.7%	97.2%	60259.0Mb	499.6M	59.0%	95.5%	65.6%
tih_rna_sample_00176_23KKJ7LT4_1_1																																	131.8bp	69.4%	173.3M																79.4%	58%	151bp	151bp	36%	261.6M
tih_rna_sample_00176_23KKJ7LT4_1_2																																																			77.4%	59%	151bp	151bp	36%	261.6M
tih_rna_sample_00176_23KKJ7LT4_1_trimmed_1																																																			78.8%	58%	124bp	132bp	18%	249.8M	78.8%	58%	124bp	132bp	18%	249.8M
tih_rna_sample_00176_23KKJ7LT4_1_trimmed_2																																																			77.7%	59%	124bp	132bp	9%	249.8M	77.7%	59%	124bp	132bp	9%	249.8M
tih_rna_sample_00179_23KKJ7LT4_1	9999000000	206842690	141.3bp	133.0bp	1.57%	1.10%	0.67%	0.00%	3.40%	3.34%	0.92%	0.00%	588164964	0.01%	0.60%	232933876	0.59%	0.62%	0.38%	0.38%	136297482	68992036	88369462	42939818	251.47	106.00	0.66%	0.51%	0.98	0.000	No	0.00%				141bp	189bp	61.3%	0.0%	79.1%	73.4%	90.6%	266.4M	41.5%	97.7%	73885.9Mb	588.2M	55.0%	98.0%	58.1%
tih_rna_sample_00179_23KKJ7LT4_1_1																																	141.3bp	76.7%	225.6M																78.1%	54%	151bp	151bp	27%	368.7M
tih_rna_sample_00179_23KKJ7LT4_1_2																																																			76.1%	55%	151bp	151bp	18%	368.7M
tih_rna_sample_00179_23KKJ7LT4_1_trimmed_1																																																			75.7%	54%	128bp	137bp	18%	294.1M	75.7%	54%	128bp	137bp	18%	294.1M
tih_rna_sample_00179_23KKJ7LT4_1_trimmed_2																																																			74.5%	55%	129bp	142bp	18%	294.1M	74.5%	55%	129bp	142bp	18%	294.1M
tih_rna_sample_00180_23KKJ7LT4_1	9999000000	252031615	141.6bp	134.0bp	0.38%	0.82%	0.51%	0.00%	0.82%	2.44%	0.75%	0.00%	589589940	0.02%	0.56%	257625198	0.64%	0.68%	0.32%	0.32%	163852337	82875006	81502217	39346259	303.68	79.00	0.64%	0.46%	0.98	0.000	No	0.00%				143bp	188bp	57.5%	0.0%	80.4%	69.9%	89.1%	262.8M	38.7%	97.3%	74237.4Mb	589.6M	61.1%	98.3%	57.9%
tih_rna_sample_00180_23KKJ7LT4_1_1																																	141.6bp	77.3%	227.9M																80.2%	59%	151bp	151bp	27%	463.7M
tih_rna_sample_00180_23KKJ7LT4_1_2																																																			78.9%	60%	151bp	151bp	27%	463.7M
tih_rna_sample_00180_23KKJ7LT4_1_trimmed_1																																																			76.0%	60%	129bp	142bp	27%	294.8M	76.0%	60%	129bp	142bp	27%	294.8M
tih_rna_sample_00180_23KKJ7LT4_1_trimmed_2																																																			75.7%	61%	130bp	142bp	18%	294.8M	75.7%	61%	130bp	142bp	18%	294.8M
tih_rna_sample_00183_23KKJ7LT4_1	9999000000	232485823	133.2bp	127.0bp	1.93%	0.74%	0.69%	0.00%	3.81%	2.12%	0.91%	0.00%	584754950	0.01%	0.57%	252347945	0.48%	0.51%	0.48%	0.49%	121508794	61426062	122246840	60052981	211.61	97.00	0.67%	0.50%	0.98	0.000	No	0.00%				132bp	161bp	57.7%	0.0%	69.5%	76.5%	92.1%	269.3M	38.6%	97.8%	71205.0Mb	584.8M	52.3%	97.5%	64.0%
tih_rna_sample_00183_23KKJ7LT4_1_1																																	133.2bp	68.0%	198.7M																70.8%	52%	151bp	151bp	27%	303.0M
tih_rna_sample_00183_23KKJ7LT4_1_2																																																			68.9%	53%	151bp	151bp	45%	303.0M
tih_rna_sample_00183_23KKJ7LT4_1_trimmed_1																																																			70.3%	52%	124bp	132bp	18%	292.4M	70.3%	52%	124bp	132bp	18%	292.4M
tih_rna_sample_00183_23KKJ7LT4_1_trimmed_2																																																			69.0%	52%	125bp	132bp	9%	292.4M	69.0%	52%	125bp	132bp	9%	292.4M
tih_rna_sample_00184_23KKJ7LT4_1	9999000000	310536641	140.3bp	133.0bp	0.62%	0.58%	0.55%	0.00%	1.32%	1.88%	0.78%	0.00%	592049622	0.01%	0.51%	291293877	0.61%	0.63%	0.36%	0.37%	177264533	89626025	106168846	51681942	332.71	145.00	0.71%	0.57%	0.98	0.000	No	0.00%				143bp	192bp	51.5%	0.0%	76.7%	78.5%	92.1%	272.6M	35.8%	97.9%	74789.5Mb	592.0M	55.2%	98.7%	57.7%
tih_rna_sample_00184_23KKJ7LT4_1_1																																	140.3bp	75.4%	223.1M																76.7%	54%	151bp	151bp	27%	483.7M
tih_rna_sample_00184_23KKJ7LT4_1_2																																																			75.2%	55%	151bp	151bp	27%	483.7M
tih_rna_sample_00184_23KKJ7LT4_1_trimmed_1																																																			71.4%	55%	129bp	142bp	27%	296.0M	71.4%	55%	129bp	142bp	27%	296.0M
tih_rna_sample_00184_23KKJ7LT4_1_trimmed_2																																																			70.6%	55%	129bp	142bp	18%	296.0M	70.6%	55%	129bp	142bp	18%	296.0M
tih_rna_sample_00185_23KKJ7LT4_1	9999000000	286280943	132.6bp	126.0bp	0.82%	0.90%	0.62%	0.00%	1.91%	2.89%	0.84%	0.00%	573024386	0.01%	0.52%	276137300	0.41%	0.43%	0.56%	0.57%	113121666	57187146	154680325	76380684	197.49	97.00	0.68%	0.49%	0.98	0.000	No	0.00%				132bp	154bp	52.6%	0.0%	61.4%	81.4%	93.4%	267.7M	34.2%	97.8%	70013.0Mb	573.0M	49.6%	98.5%	64.6%
tih_rna_sample_00185_23KKJ7LT4_1_1																																	132.6bp	60.6%	173.6M																66.2%	50%	151bp	151bp	27%	290.9M
tih_rna_sample_00185_23KKJ7LT4_1_2																																																			63.9%	50%	151bp	151bp	27%	290.9M
tih_rna_sample_00185_23KKJ7LT4_1_trimmed_1																																																			66.0%	49%	125bp	132bp	18%	286.5M	66.0%	49%	125bp	132bp	18%	286.5M
tih_rna_sample_00185_23KKJ7LT4_1_trimmed_2																																																			64.2%	49%	125bp	132bp	9%	286.5M	64.2%	49%	125bp	132bp	9%	286.5M
tih_rna_sample_00186_23KKJ7LT4_1	9999000000	288018785	154.0bp	142.0bp	1.55%	0.89%	0.56%	0.00%	3.11%	2.51%	0.71%	0.00%	593310602	0.01%	0.54%	274866564	0.66%	0.69%	0.32%	0.31%	181946325	92227738	87760819	42210031	370.37	164.00	0.73%	0.59%	0.98	0.000	No	0.00%				162bp	269bp	54.1%	0.0%	81.6%	85.3%	94.4%	280.0M	40.1%	98.0%	78063.8Mb	593.3M	53.3%	98.9%	48.1%
tih_rna_sample_00186_23KKJ7LT4_1_1																																	154.0bp	80.4%	238.5M																79.3%	52%	151bp	151bp	27%	459.5M
tih_rna_sample_00186_23KKJ7LT4_1_2																																																			77.4%	53%	151bp	151bp	18%	459.5M
tih_rna_sample_00186_23KKJ7LT4_1_trimmed_1																																																			75.3%	53%	134bp	151bp	27%	296.7M	75.3%	53%	134bp	151bp	27%	296.7M
tih_rna_sample_00186_23KKJ7LT4_1_trimmed_2																																																			73.9%	53%	134bp	151bp	18%	296.7M	73.9%	53%	134bp	151bp	18%	296.7M
tih_rna_sample_00198_23KKJ7LT4_1	9999000000	204851566	123.2bp	119.0bp	1.35%	0.78%	0.66%	0.00%	2.88%	2.29%	0.85%	0.00%	485378374	0.01%	0.55%	216058758	0.43%	0.45%	0.54%	0.55%	92725880	46790322	116679428	57600720	149.40	71.00	0.65%	0.42%	0.98	0.000	No	0.00%				122bp	141bp	56.3%	0.0%	66.3%	76.2%	92.3%	224.0M	35.7%	98.0%	56974.0Mb	485.4M	50.3%	97.9%	72.7%
tih_rna_sample_00198_23KKJ7LT4_1_1																																	123.2bp	65.5%	159.0M																68.2%	51%	151bp	151bp	27%	247.9M
tih_rna_sample_00198_23KKJ7LT4_1_2																																																			66.0%	51%	151bp	151bp	45%	247.9M
tih_rna_sample_00198_23KKJ7LT4_1_trimmed_1																																																			67.9%	50%	120bp	122bp	18%	242.7M	67.9%	50%	120bp	122bp	18%	242.7M
tih_rna_sample_00198_23KKJ7LT4_1_trimmed_2																																																			66.3%	50%	120bp	122bp	9%	242.7M	66.3%	50%	120bp	122bp	9%	242.7M
tih_rna_sample_00200_23KKJ7LT4_1	9999000000	54666097	136.0bp	130.0bp	2.37%	0.44%	0.29%	0.00%	4.80%	1.24%	0.41%	0.00%	201663408	0.03%	0.67%	66179622	0.29%	0.32%	0.62%	0.68%	19216346	9729205	40920902	20207678	32.04	12.00	0.28%	0.06%	0.98	0.000	No	0.00%				131bp	150bp	69.3%	0.0%	63.4%	61.9%	86.2%	86.9M	46.6%	97.3%	24465.4Mb	201.7M	55.6%	92.5%	62.4%
tih_rna_sample_00200_23KKJ7LT4_1_1																																	136.0bp	59.0%	59.5M																73.7%	56%	151bp	151bp	45%	109.1M
tih_rna_sample_00200_23KKJ7LT4_1_2																																																			71.3%	58%	151bp	151bp	36%	109.1M
tih_rna_sample_00200_23KKJ7LT4_1_trimmed_1																																																			71.8%	55%	124bp	132bp	18%	100.8M	71.8%	55%	124bp	132bp	18%	100.8M
tih_rna_sample_00200_23KKJ7LT4_1_trimmed_2																																																			70.3%	55%	125bp	132bp	9%	100.8M	70.3%	55%	125bp	132bp	9%	100.8M
tih_rna_sample_00202_23KKJ7LT4_1	9999000000	330179385	147.4bp	137.0bp	0.95%	0.85%	0.66%	0.00%	2.01%	2.54%	0.86%	0.00%	591884706	0.01%	0.49%	301467775	0.59%	0.61%	0.39%	0.39%	177386036	89956487	118289724	57459595	346.59	169.00	0.72%	0.59%	0.98	0.000	No	0.00%				149bp	212bp	49.6%	0.0%	74.2%	85.9%	94.7%	280.2M	36.2%	98.2%	75892.0Mb	591.9M	50.9%	98.6%	52.9%
tih_rna_sample_00202_23KKJ7LT4_1_1																																	147.4bp	73.2%	216.7M																77.7%	51%	151bp	151bp	27%	506.9M
tih_rna_sample_00202_23KKJ7LT4_1_2																																																			75.0%	51%	151bp	151bp	18%	506.9M
tih_rna_sample_00202_23KKJ7LT4_1_trimmed_1																																																			71.8%	50%	131bp	147bp	27%	295.9M	71.8%	50%	131bp	147bp	27%	295.9M
tih_rna_sample_00202_23KKJ7LT4_1_trimmed_2																																																			69.5%	51%	131bp	147bp	18%	295.9M	69.5%	51%	131bp	147bp	18%	295.9M
tih_rna_sample_00204_23KKJ7LT4_1	9999000000	4961533	100.0bp	97.0bp	1.84%	0.51%	0.65%	0.00%	3.45%	1.34%	0.73%	0.00%	13030866	0.12%	0.50%	6569116	0.13%	0.18%	0.62%	0.82%	855560	430652	4086678	2028827	1.02	0.00	0.00%	0.00%	0.98	0.000	Skipped	N/A%				93bp	96bp	56.7%	0.0%	39.1%	39.8%	73.0%	4.8M	56.0%	97.3%	1240.5Mb	13.0M	50.9%	38.3%	63.9%
tih_rna_sample_00204_23KKJ7LT4_1_1																																	100.0bp	33.4%	2.2M																84.2%	65%	151bp	151bp	55%	17.0M
tih_rna_sample_00204_23KKJ7LT4_1_2																																																			83.1%	80%	151bp	151bp	55%	17.0M
tih_rna_sample_00204_23KKJ7LT4_1_trimmed_1																																																			57.1%	50%	98bp	97bp	18%	6.5M	57.1%	50%	98bp	97bp	18%	6.5M
tih_rna_sample_00204_23KKJ7LT4_1_trimmed_2																																																			56.8%	51%	98bp	102bp	18%	6.5M	56.8%	51%	98bp	102bp	18%	6.5M
tih_rna_sample_00206_23KKJ7LT4_1	9999000000	304729939	164.3bp	151.0bp	0.73%	0.85%	0.45%	0.00%	1.68%	2.81%	0.65%	0.00%	593346570	0.01%	0.52%	286516444	0.62%	0.64%	0.36%	0.36%	176791439	89923212	104366201	50218954	374.69	185.00	0.74%	0.61%	0.98	0.000	No	0.00%				178bp	281bp	52.2%	0.0%	76.8%	86.1%	94.8%	281.3M	39.3%	98.0%	79753.6Mb	593.3M	53.5%	98.9%	40.9%
tih_rna_sample_00206_23KKJ7LT4_1_1																																	164.3bp	76.3%	226.3M																76.4%	53%	151bp	151bp	27%	436.1M
tih_rna_sample_00206_23KKJ7LT4_1_2																																																			74.4%	53%	151bp	151bp	18%	436.1M
tih_rna_sample_00206_23KKJ7LT4_1_trimmed_1																																																			72.5%	53%	137bp	151bp	27%	296.7M	72.5%	53%	137bp	151bp	27%	296.7M
tih_rna_sample_00206_23KKJ7LT4_1_trimmed_2																																																			70.9%	53%	137bp	151bp	18%	296.7M	70.9%	53%	137bp	151bp	18%	296.7M
tih_rna_sample_00207_23KKJ7LT4_1	9999000000	247966619	139.0bp	130.0bp	1.41%	0.46%	0.45%	0.00%	2.76%	1.32%	0.61%	0.00%	589763520	0.01%	0.55%	263251386	0.50%	0.52%	0.47%	0.48%	131641170	66692348	123546766	60493094	238.63	107.00	0.67%	0.51%	0.98	0.000	No	0.00%				135bp	167bp	56.1%	0.0%	70.1%	78.1%	92.4%	272.6M	38.9%	97.9%	73368.1Mb	589.8M	52.8%	98.3%	60.3%
tih_rna_sample_00207_23KKJ7LT4_1_1																																	139.0bp	68.1%	200.9M																71.9%	52%	151bp	151bp	27%	315.5M
tih_rna_sample_00207_23KKJ7LT4_1_2																																																			69.2%	53%	151bp	151bp	27%	315.5M
tih_rna_sample_00207_23KKJ7LT4_1_trimmed_1																																																			71.1%	52%	127bp	137bp	18%	294.9M	71.1%	52%	127bp	137bp	18%	294.9M
tih_rna_sample_00207_23KKJ7LT4_1_trimmed_2																																																			69.1%	53%	127bp	137bp	18%	294.9M	69.1%	53%	127bp	137bp	18%	294.9M
tih_rna_sample_00208_23KKJ7LT4_1	9999000000	391020614	147.2bp	137.0bp	1.15%	1.65%	0.51%	0.00%	2.53%	4.71%	0.71%	0.00%	592400524	0.01%	0.45%	328196833	0.65%	0.67%	0.33%	0.33%	214363804	108675373	109854260	52957406	427.86	164.00	0.68%	0.56%	0.98	0.000	Yes	0.12%				153bp	227bp	44.9%	0.0%	78.4%	86.7%	95.1%	281.8M	33.1%	97.8%	76256.5Mb	592.4M	51.3%	98.7%	51.9%
tih_rna_sample_00208_23KKJ7LT4_1_1																																	147.2bp	77.9%	230.8M																74.8%	51%	151bp	151bp	27%	386.8M
tih_rna_sample_00208_23KKJ7LT4_1_2																																																			73.4%	51%	151bp	151bp	18%	386.8M
tih_rna_sample_00208_23KKJ7LT4_1_trimmed_1																																																			72.2%	51%	132bp	147bp	18%	296.2M	72.2%	51%	132bp	147bp	18%	296.2M
tih_rna_sample_00208_23KKJ7LT4_1_trimmed_2																																																			71.4%	51%	132bp	147bp	9%	296.2M	71.4%	51%	132bp	147bp	9%	296.2M
tih_rna_sample_00216_23KKJ7LT4_1	9999000000	47628148	103.6bp	101.0bp	1.14%	0.56%	0.39%	0.00%	2.65%	1.83%	0.55%	0.00%	124450026	0.02%	0.61%	48438494	0.28%	0.30%	0.66%	0.70%	13633904	6850806	32208359	15989032	17.53	7.00	0.15%	0.02%	0.98	0.000	No	0.00%				103bp	114bp	62.4%	0.0%	62.4%	69.3%	90.5%	56.3M	36.8%	97.5%	12593.7Mb	124.5M	52.2%	88.9%	84.0%
tih_rna_sample_00216_23KKJ7LT4_1_1																																	103.6bp	60.8%	37.9M																67.3%	54%	151bp	151bp	45%	70.0M
tih_rna_sample_00216_23KKJ7LT4_1_2																																																			65.7%	57%	151bp	151bp	45%	70.0M
tih_rna_sample_00216_23KKJ7LT4_1_trimmed_1																																																			63.5%	52%	104bp	102bp	18%	62.2M	63.5%	52%	104bp	102bp	18%	62.2M
tih_rna_sample_00216_23KKJ7LT4_1_trimmed_2																																																			62.4%	52%	104bp	102bp	9%	62.2M	62.4%	52%	104bp	102bp	9%	62.2M
tih_rna_sample_00219_23KKJ7LT4_1	9999000000	138427320	145.0bp	136.0bp	0.30%	0.34%	0.34%	0.00%	0.68%	1.13%	0.53%	0.00%	584010416	0.01%	0.71%	168045581	0.43%	0.45%	0.53%	0.55%	71592197	36275764	88959298	43613265	132.21	58.00	0.61%	0.37%	0.98	0.000	No	0.00%				145bp	188bp	72.2%	0.0%	76.2%	79.3%	92.9%	271.4M	55.6%	97.5%	74580.6Mb	584.0M	55.4%	97.3%	55.5%
tih_rna_sample_00219_23KKJ7LT4_1_1																																	145.0bp	74.7%	218.1M																80.0%	54%	151bp	151bp	36%	335.3M
tih_rna_sample_00219_23KKJ7LT4_1_2																																																			78.2%	55%	151bp	151bp	27%	335.3M
tih_rna_sample_00219_23KKJ7LT4_1_trimmed_1																																																			78.6%	55%	131bp	142bp	18%	292.0M	78.6%	55%	131bp	142bp	18%	292.0M
tih_rna_sample_00219_23KKJ7LT4_1_trimmed_2																																																			77.7%	55%	131bp	142bp	9%	292.0M	77.7%	55%	131bp	142bp	9%	292.0M
tih_rna_sample_00223_23KKJ7LT4_1	9999000000	208755790	147.1bp	137.0bp	0.69%	0.67%	0.39%	0.00%	1.28%	1.82%	0.51%	0.00%	590026700	0.01%	0.62%	222333340	0.66%	0.69%	0.32%	0.31%	147640983	74706104	70046884	33695703	287.14	116.00	0.68%	0.53%	0.98	0.000	No	0.00%				153bp	266bp	62.8%	0.0%	85.5%	83.2%	93.8%	276.8M	46.2%	97.7%	75588.4Mb	590.0M	53.4%	98.3%	54.9%
tih_rna_sample_00223_23KKJ7LT4_1_1																																	147.1bp	84.4%	249.0M																81.1%	53%	151bp	151bp	27%	417.2M
tih_rna_sample_00223_23KKJ7LT4_1_2																																																			79.6%	53%	151bp	151bp	18%	417.2M
tih_rna_sample_00223_23KKJ7LT4_1_trimmed_1																																																			78.1%	53%	131bp	142bp	18%	295.0M	78.1%	53%	131bp	142bp	18%	295.0M
tih_rna_sample_00223_23KKJ7LT4_1_trimmed_2																																																			77.4%	53%	131bp	142bp	9%	295.0M	77.4%	53%	131bp	142bp	9%	295.0M
tih_rna_sample_00224_23KKJ7LT4_1	9999000000	172961571	126.3bp	121.0bp	1.14%	0.56%	0.39%	0.00%	2.80%	1.93%	0.61%	0.00%	584755096	0.01%	0.66%	199819491	0.55%	0.57%	0.42%	0.43%	109274797	55117861	83550365	40918132	187.91	88.00	0.68%	0.47%	0.98	0.000	No	0.00%				125bp	155bp	66.6%	0.0%	80.8%	74.8%	90.3%	263.9M	47.0%	97.6%	69529.5Mb	584.8M	54.6%	97.5%	69.5%
tih_rna_sample_00224_23KKJ7LT4_1_1																																	126.3bp	79.6%	232.8M																78.9%	54%	151bp	151bp	36%	326.4M
tih_rna_sample_00224_23KKJ7LT4_1_2																																																			76.2%	54%	151bp	151bp	36%	326.4M
tih_rna_sample_00224_23KKJ7LT4_1_trimmed_1																																																			77.8%	54%	122bp	127bp	27%	292.4M	77.8%	54%	122bp	127bp	27%	292.4M
tih_rna_sample_00224_23KKJ7LT4_1_trimmed_2																																																			76.0%	54%	122bp	127bp	18%	292.4M	76.0%	54%	122bp	127bp	18%	292.4M
tih_rna_sample_00225_23KKJ7LT4_1	9999000000	366191523	141.5bp	132.0bp	0.96%	1.07%	0.49%	0.00%	2.08%	3.32%	0.66%	0.00%	592669818	0.01%	0.46%	321035483	0.65%	0.67%	0.34%	0.33%	207371524	104943826	108874494	52702878	398.54	187.00	0.76%	0.61%	0.98	0.000	No	0.00%				142bp	199bp	46.2%	0.0%	78.5%	85.8%	94.9%	281.2M	34.1%	97.8%	74554.3Mb	592.7M	51.5%	98.8%	57.5%
tih_rna_sample_00225_23KKJ7LT4_1_1																																	141.5bp	78.2%	231.7M																76.9%	51%	151bp	151bp	27%	466.7M
tih_rna_sample_00225_23KKJ7LT4_1_2																																																			74.2%	52%	151bp	151bp	18%	466.7M
tih_rna_sample_00225_23KKJ7LT4_1_trimmed_1																																																			72.3%	51%	129bp	142bp	18%	296.3M	72.3%	51%	129bp	142bp	18%	296.3M
tih_rna_sample_00225_23KKJ7LT4_1_trimmed_2																																																			70.0%	51%	129bp	142bp	9%	296.3M	70.0%	51%	129bp	142bp	9%	296.3M
tih_rna_sample_00226_23KKJ7LT4_1	9999000000	73670816	129.7bp	123.0bp	0.06%	0.25%	0.23%	0.00%	0.12%	0.77%	0.46%	0.00%	569060288	0.04%	0.81%	107974787	0.40%	0.50%	0.41%	0.50%	42736627	21575684	44687987	21762358	68.40	6.00	0.30%	0.15%	0.97	0.000	No	0.00%				133bp	179bp	84.1%	0.0%	80.8%	55.0%	83.2%	236.7M	56.3%	96.3%	67123.1Mb	569.1M	67.2%	94.8%	67.4%
tih_rna_sample_00226_23KKJ7LT4_1_1																																	129.7bp	75.9%	216.0M																88.4%	64%	151bp	151bp	36%	319.1M
tih_rna_sample_00226_23KKJ7LT4_1_2																																																			85.5%	65%	151bp	151bp	27%	319.1M
tih_rna_sample_00226_23KKJ7LT4_1_trimmed_1																																																			87.9%	67%	122bp	127bp	18%	284.5M	87.9%	67%	122bp	127bp	18%	284.5M
tih_rna_sample_00226_23KKJ7LT4_1_trimmed_2																																																			86.5%	67%	123bp	127bp	9%	284.5M	86.5%	67%	123bp	127bp	9%	284.5M
tih_rna_sample_00234_23KKJ7LT4_1	9999000000	298070222	137.0bp	130.0bp	1.32%	0.66%	0.74%	0.00%	2.87%	1.99%	0.99%	0.00%	591562698	0.01%	0.50%	293349621	0.59%	0.61%	0.39%	0.39%	173144520	87472853	113644948	55516921	317.70	130.00	0.69%	0.55%	0.98	0.000	No	0.00%				139bp	186bp	51.0%	0.0%	75.6%	83.0%	93.9%	277.7M	33.5%	98.0%	73756.9Mb	591.6M	51.9%	98.6%	60.2%
tih_rna_sample_00234_23KKJ7LT4_1_1																																	137.0bp	74.3%	219.7M																73.8%	52%	151bp	151bp	27%	390.3M
tih_rna_sample_00234_23KKJ7LT4_1_2																																																			72.1%	52%	151bp	151bp	18%	390.3M
tih_rna_sample_00234_23KKJ7LT4_1_trimmed_1																																																			70.6%	51%	127bp	137bp	18%	295.8M	70.6%	51%	127bp	137bp	18%	295.8M
tih_rna_sample_00234_23KKJ7LT4_1_trimmed_2																																																			69.7%	52%	127bp	137bp	18%	295.8M	69.7%	52%	127bp	137bp	18%	295.8M
tih_rna_sample_00239_23KKJ7LT4_1	9999000000	201398616	130.2bp	124.0bp	0.47%	0.49%	0.34%	0.00%	1.09%	1.62%	0.50%	0.00%	556505198	0.01%	0.60%	223436081	0.43%	0.45%	0.54%	0.55%	96415466	48690055	119842655	59053046	164.69	75.00	0.64%	0.44%	0.98	0.000	No	0.00%				130bp	159bp	60.6%	0.0%	69.1%	80.6%	93.2%	259.2M	42.9%	97.6%	67210.9Mb	556.5M	52.2%	97.8%	67.1%
tih_rna_sample_00239_23KKJ7LT4_1_1																																	130.2bp	68.4%	190.2M																73.0%	52%	151bp	151bp	27%	284.4M
tih_rna_sample_00239_23KKJ7LT4_1_2																																																			70.2%	52%	151bp	151bp	27%	284.4M
tih_rna_sample_00239_23KKJ7LT4_1_trimmed_1																																																			72.8%	52%	124bp	127bp	18%	278.3M	72.8%	52%	124bp	127bp	18%	278.3M
tih_rna_sample_00239_23KKJ7LT4_1_trimmed_2																																																			70.7%	52%	124bp	132bp	9%	278.3M	70.7%	52%	124bp	132bp	9%	278.3M
tih_rna_sample_00243_23KKJ7LT4_1	9999000000	241210161	120.4bp	115.0bp	3.89%	1.00%	0.60%	0.00%	7.52%	2.85%	0.80%	0.00%	588825014	0.01%	0.57%	252443038	0.60%	0.63%	0.37%	0.37%	152024705	76626903	93389703	45658271	252.53	111.00	0.69%	0.52%	0.98	0.000	No	0.00%				119bp	150bp	57.8%	0.0%	80.6%	78.7%	92.7%	273.0M	36.3%	97.7%	67902.8Mb	588.8M	53.8%	98.1%	73.8%
tih_rna_sample_00243_23KKJ7LT4_1_1																																	120.4bp	78.9%	232.4M																76.8%	53%	151bp	151bp	27%	340.4M
tih_rna_sample_00243_23KKJ7LT4_1_2																																																			74.6%	54%	151bp	151bp	27%	340.4M
tih_rna_sample_00243_23KKJ7LT4_1_trimmed_1																																																			75.3%	53%	118bp	122bp	18%	294.4M	75.3%	53%	118bp	122bp	18%	294.4M
tih_rna_sample_00243_23KKJ7LT4_1_trimmed_2																																																			73.8%	53%	118bp	122bp	9%	294.4M	73.8%	53%	118bp	122bp	9%	294.4M
tih_rna_sample_00244_23KKJ7LT4_1	9999000000	264893416	138.2bp	129.0bp	0.62%	0.67%	0.40%	0.00%	1.46%	2.28%	0.59%	0.00%	592519680	0.01%	0.55%	267944078	0.60%	0.62%	0.38%	0.38%	161275694	81627489	101370954	49312771	304.61	155.00	0.73%	0.58%	0.98	0.000	No	0.00%				147bp	221bp	55.3%	0.0%	78.1%	86.2%	95.0%	281.6M	39.8%	97.8%	74373.3Mb	592.5M	52.8%	98.8%	58.7%
tih_rna_sample_00244_23KKJ7LT4_1_1																																	138.2bp	77.9%	230.9M																78.2%	52%	151bp	151bp	27%	422.9M
tih_rna_sample_00244_23KKJ7LT4_1_2																																																			75.7%	53%	151bp	151bp	18%	422.9M
tih_rna_sample_00244_23KKJ7LT4_1_trimmed_1																																																			74.6%	52%	128bp	137bp	18%	296.3M	74.6%	52%	128bp	137bp	18%	296.3M
tih_rna_sample_00244_23KKJ7LT4_1_trimmed_2																																																			72.5%	52%	128bp	137bp	9%	296.3M	72.5%	52%	128bp	137bp	9%	296.3M
tih_rna_sample_00245_23KKJ7LT4_1	9999000000	314186269	136.6bp	127.0bp	1.14%	0.92%	0.61%	0.00%	2.54%	2.86%	0.86%	0.00%	591918986	0.01%	0.49%	299489132	0.68%	0.71%	0.29%	0.29%	203797363	102960843	88162988	42529931	380.15	187.00	0.72%	0.60%	0.98	0.000	No	0.00%				137bp	201bp	50.0%	0.0%	83.6%	84.6%	94.1%	278.6M	33.9%	97.7%	72822.0Mb	591.9M	53.3%	98.7%	61.9%
tih_rna_sample_00245_23KKJ7LT4_1_1																																	136.6bp	82.2%	243.4M																79.9%	52%	151bp	151bp	27%	517.0M
tih_rna_sample_00245_23KKJ7LT4_1_2																																																			77.7%	53%	151bp	151bp	18%	517.0M
tih_rna_sample_00245_23KKJ7LT4_1_trimmed_1																																																			74.5%	53%	126bp	132bp	18%	296.0M	74.5%	53%	126bp	132bp	18%	296.0M
tih_rna_sample_00245_23KKJ7LT4_1_trimmed_2																																																			72.8%	53%	126bp	132bp	9%	296.0M	72.8%	53%	126bp	132bp	9%	296.0M
tih_rna_sample_00247_23KKJ7LT4_1	9999000000	172528232	123.7bp	118.0bp	1.11%	0.44%	0.29%	0.00%	2.69%	1.39%	0.42%	0.00%	432266458	0.02%	0.58%	183252433	0.32%	0.33%	0.65%	0.67%	57849722	29193435	118532017	58651073	92.11	36.00	0.53%	0.28%	0.98	0.000	No	0.00%				119bp	133bp	58.5%	0.0%	60.0%	75.5%	92.0%	198.8M	39.9%	97.5%	50039.8Mb	432.3M	52.5%	97.1%	73.2%
tih_rna_sample_00247_23KKJ7LT4_1_1																																	123.7bp	59.6%	128.7M																68.7%	52%	151bp	151bp	27%	222.6M
tih_rna_sample_00247_23KKJ7LT4_1_2																																																			65.9%	53%	151bp	151bp	36%	222.6M
tih_rna_sample_00247_23KKJ7LT4_1_trimmed_1																																																			68.3%	52%	119bp	122bp	18%	216.1M	68.3%	52%	119bp	122bp	18%	216.1M
tih_rna_sample_00247_23KKJ7LT4_1_trimmed_2																																																			66.2%	52%	119bp	122bp	9%	216.1M	66.2%	52%	119bp	122bp	9%	216.1M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Custom content: SeqTools (general stats)	Reads	SeqTools (general stats) — reads	`reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Unmapped	SeqTools (general stats) — frac unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools (general stats)	Frac Dupes	SeqTools (general stats) — frac dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools (general stats)	Unique Reads	SeqTools (general stats) — unique reads	`unique_reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads On Target	SeqTools (general stats) — frac reads on target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs On Target	SeqTools (general stats) — frac pairs on target	`frac_pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads Off Target	SeqTools (general stats) — frac reads off target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs Off Target	SeqTools (general stats) — frac pairs off target	`frac_pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads On Target	SeqTools (general stats) — reads on target	`reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs On Target	SeqTools (general stats) — pairs on target	`pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads Off Target	SeqTools (general stats) — reads off target	`reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs Off Target	SeqTools (general stats) — pairs off target	`pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Mean Depth	SeqTools (general stats) — mean depth	`mean_depth`	None
\|\|	Custom content: SeqTools (general stats)	Q50 Depth	SeqTools (general stats) — q50 depth	`q50_depth`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt30X	SeqTools (general stats) — frac bases gt30x	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt100X	SeqTools (general stats) — frac bases gt100x	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools (general stats)	N Q30	SeqTools (general stats) — n q30	`n_q30`	None
\|\|	Custom content: SeqTools (general stats)	GC Bias	SeqTools (general stats) — Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: InsertSizeMetrics	Insert Size	Median Insert Size, all read orientations (bp)	`summed_median`	None
\|\|	Picard: InsertSizeMetrics	Mean Insert Size	Mean Insert Size, all read orientations (bp)	`summed_mean`	None
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	Picard: RnaSeqMetrics	rRNA	Percent of aligned bases overlapping ribosomal RNA regions	`PCT_RIBOSOMAL_BASES`	None
\|\|	Picard: RnaSeqMetrics	mRNA	Percent of aligned bases overlapping UTRs and coding regions of mRNA transcripts	`PCT_MRNA_BASES`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Insert Size

Plot shows the number of reads at a given insert size. Reads with different orientations are summed.

Created with MultiQC

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

RnaSeqMetrics Assignment

Number of bases in primary alignments that align to regions in the reference genome.

Created with MultiQC

Gene Coverage

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁹⁶/₉₆ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
FFPE_HD789_02_RNA_0005_23KKJ7LT4_1	666.9M	0.0M	0.0M	71.1M	4.1M	566.5M	283.4M	283.2M	283.3M	283.3M	323.6M	242.9M	564.5M	0.0M
FFPE_HD789_02_RNA_0006_23KKJ7LT4_1	658.0M	0.0M	0.0M	63.0M	3.5M	568.4M	284.3M	284.1M	284.2M	284.2M	310.5M	257.9M	566.5M	0.0M
FFPE_V4_0001_RNA_0002_23KKJ7LT4_1	630.3M	0.0M	0.0M	72.3M	4.7M	527.1M	263.7M	263.4M	263.6M	263.5M	302.6M	224.5M	525.1M	0.0M
FFPE_V4_0001_RNA_0003_23KKJ7LT4_1	678.4M	0.0M	0.0M	84.0M	5.9M	557.9M	279.1M	278.8M	279.0M	279.0M	340.1M	217.8M	556.0M	0.0M
NTC_0001_0001_23KKJ7LT4_1	3.2M	0.0M	0.0M	2.3M	0.5M	0.1M	0.0M	0.0M	0.0M	0.0M	0.1M	0.0M	0.1M	0.0M
NTC_0001_0001_23KKJ7LT4_2	3.4M	0.0M	0.0M	2.6M	0.4M	0.1M	0.0M	0.0M	0.0M	0.0M	0.1M	0.0M	0.1M	0.0M
tih_rna_sample_00001_23KKJ7LT4_1	679.3M	0.0M	0.0M	86.5M	7.6M	553.7M	276.9M	276.7M	276.8M	276.8M	374.1M	179.5M	551.5M	0.0M
tih_rna_sample_00002_23KKJ7LT4_1	662.9M	0.0M	0.0M	66.9M	5.8M	567.9M	284.1M	283.8M	284.0M	283.9M	411.4M	156.5M	565.5M	0.0M
tih_rna_sample_00004_23KKJ7LT4_1	670.8M	0.0M	0.0M	74.9M	5.8M	564.3M	282.2M	282.1M	282.1M	282.1M	368.6M	195.7M	561.9M	0.0M
tih_rna_sample_00005_23KKJ7LT4_1	480.6M	0.0M	0.0M	103.9M	7.6M	340.5M	170.3M	170.2M	170.2M	170.2M	230.8M	109.7M	338.9M	0.0M
tih_rna_sample_00006_23KKJ7LT4_1	711.2M	0.0M	0.0M	116.4M	7.5M	552.5M	276.4M	276.1M	276.3M	276.2M	364.6M	188.0M	549.9M	0.0M
tih_rna_sample_00007_23KKJ7LT4_1	683.2M	0.0M	0.0M	91.3M	7.4M	555.1M	277.7M	277.4M	277.5M	277.5M	385.1M	170.0M	552.7M	0.0M
tih_rna_sample_00008_23KKJ7LT4_1	190.0M	0.0M	0.0M	48.5M	3.8M	126.8M	63.4M	63.4M	63.4M	63.4M	108.6M	18.2M	126.1M	0.0M
tih_rna_sample_00009_23KKJ7LT4_1	738.0M	0.0M	0.0M	149.9M	17.7M	526.2M	263.3M	262.9M	263.1M	263.1M	372.3M	153.9M	524.0M	0.0M
tih_rna_sample_00010_23KKJ7LT4_1	662.8M	0.0M	0.0M	66.5M	6.7M	567.9M	284.1M	283.8M	284.0M	283.9M	353.5M	214.4M	565.3M	0.0M
tih_rna_sample_00012_23KKJ7LT4_1	686.7M	0.0M	0.0M	93.2M	9.1M	555.1M	277.8M	277.4M	277.6M	277.5M	379.4M	175.7M	552.5M	0.0M
tih_rna_sample_00013_23KKJ7LT4_1	546.6M	0.0M	0.0M	88.3M	8.5M	424.0M	212.1M	211.9M	212.0M	212.0M	307.2M	116.8M	421.9M	0.0M
tih_rna_sample_00015_23KKJ7LT4_1	667.8M	0.0M	0.0M	71.7M	5.4M	566.8M	283.6M	283.2M	283.5M	283.4M	352.8M	214.1M	564.4M	0.0M
tih_rna_sample_00016_23KKJ7LT4_1	564.6M	0.0M	0.0M	129.4M	10.5M	389.8M	195.1M	194.7M	194.9M	194.9M	304.7M	85.1M	388.1M	0.0M
tih_rna_sample_00020_23KKJ7LT4_1	697.9M	0.0M	0.0M	105.0M	8.3M	552.5M	276.4M	276.0M	276.3M	276.2M	372.0M	180.5M	550.4M	0.0M
tih_rna_sample_00021_23KKJ7LT4_1	681.3M	0.0M	0.0M	86.1M	5.3M	562.5M	281.4M	281.1M	281.3M	281.3M	354.7M	207.8M	560.3M	0.0M
tih_rna_sample_00022_23KKJ7LT4_1	689.8M	0.0M	0.0M	98.8M	9.1M	550.0M	275.2M	274.8M	275.0M	275.0M	358.2M	191.8M	547.6M	0.0M
tih_rna_sample_00023_23KKJ7LT4_1	672.9M	0.0M	0.0M	76.9M	6.6M	563.4M	281.9M	281.5M	281.7M	281.7M	393.4M	170.0M	560.9M	0.0M
tih_rna_sample_00024_23KKJ7LT4_1	741.9M	0.0M	0.0M	150.4M	13.4M	535.5M	268.0M	267.5M	267.8M	267.7M	370.8M	164.7M	533.0M	0.0M
tih_rna_sample_00025_23KKJ7LT4_1	679.5M	0.0M	0.0M	84.3M	6.2M	562.3M	281.3M	281.0M	281.2M	281.1M	391.8M	170.5M	559.9M	0.0M
tih_rna_sample_00027_23KKJ7LT4_1	662.7M	0.0M	0.0M	67.2M	6.1M	569.1M	284.7M	284.4M	284.5M	284.5M	414.0M	155.1M	566.4M	0.0M
tih_rna_sample_00030_23KKJ7LT4_1	658.6M	0.0M	0.0M	62.7M	5.9M	568.2M	284.3M	283.9M	284.1M	284.1M	362.2M	206.0M	565.8M	0.0M
tih_rna_sample_00032_23KKJ7LT4_1	660.6M	0.0M	0.0M	65.3M	5.2M	566.4M	283.3M	283.0M	283.2M	283.2M	358.9M	207.4M	564.5M	0.0M
tih_rna_sample_00034_23KKJ7LT4_1	756.8M	0.0M	0.0M	209.5M	19.1M	473.7M	237.1M	236.6M	236.8M	236.8M	342.5M	131.2M	471.4M	0.0M
tih_rna_sample_00035_23KKJ7LT4_1	668.5M	0.0M	0.0M	78.7M	6.8M	558.0M	279.1M	278.9M	279.0M	279.0M	383.9M	174.1M	556.1M	0.0M
tih_rna_sample_00036_23KKJ7LT4_1	572.5M	0.0M	0.0M	114.6M	10.4M	418.2M	209.3M	208.9M	209.1M	209.1M	327.9M	90.3M	416.1M	0.0M
tih_rna_sample_00037_23KKJ7LT4_1	656.7M	0.0M	0.0M	60.4M	5.3M	569.0M	284.7M	284.3M	284.5M	284.5M	382.4M	186.6M	566.6M	0.0M
tih_rna_sample_00039_23KKJ7LT4_1	687.4M	0.0M	0.0M	94.4M	7.4M	553.1M	276.7M	276.4M	276.6M	276.6M	378.9M	174.2M	551.4M	0.0M
tih_rna_sample_00041_23KKJ7LT4_1	679.6M	0.0M	0.0M	87.4M	7.2M	556.7M	278.5M	278.2M	278.4M	278.3M	398.1M	158.6M	554.8M	0.0M
tih_rna_sample_00042_23KKJ7LT4_1	636.5M	0.0M	0.0M	79.8M	5.8M	525.9M	263.1M	262.8M	262.9M	262.9M	371.7M	154.2M	524.1M	0.0M
tih_rna_sample_00043_23KKJ7LT4_1	662.2M	0.0M	0.0M	68.7M	5.8M	565.6M	282.9M	282.7M	282.8M	282.7M	384.4M	181.2M	563.8M	0.0M
tih_rna_sample_00044_23KKJ7LT4_1	663.3M	0.0M	0.0M	70.4M	6.0M	563.7M	282.0M	281.6M	281.9M	281.8M	382.6M	181.1M	561.6M	0.0M
tih_rna_sample_00045_23KKJ7LT4_1	695.8M	0.0M	0.0M	102.9M	7.3M	551.8M	276.1M	275.7M	275.9M	275.8M	347.5M	204.3M	549.5M	0.0M
tih_rna_sample_00046_23KKJ7LT4_1	668.2M	0.0M	0.0M	74.2M	5.7M	565.0M	282.7M	282.3M	282.5M	282.4M	368.7M	196.3M	562.4M	0.0M
tih_rna_sample_00047_23KKJ7LT4_1	688.7M	0.0M	0.0M	94.6M	5.2M	558.0M	279.1M	278.9M	279.0M	279.0M	370.7M	187.3M	555.7M	0.0M
tih_rna_sample_00048_23KKJ7LT4_1	684.2M	0.0M	0.0M	92.8M	6.1M	557.3M	278.8M	278.5M	278.7M	278.6M	372.6M	184.7M	555.1M	0.0M
tih_rna_sample_00050_23KKJ7LT4_1	673.6M	0.0M	0.0M	79.1M	5.8M	561.3M	280.9M	280.5M	280.7M	280.7M	350.1M	211.3M	559.1M	0.0M
tih_rna_sample_00051_23KKJ7LT4_1	668.3M	0.0M	0.0M	72.8M	5.7M	564.8M	282.6M	282.2M	282.4M	282.4M	346.2M	218.6M	562.5M	0.0M
tih_rna_sample_00052_23KKJ7LT4_1	668.6M	0.0M	0.0M	73.1M	5.7M	560.7M	280.5M	280.2M	280.3M	280.3M	326.1M	234.6M	558.8M	0.0M
tih_rna_sample_00053_23KKJ7LT4_1	405.7M	0.0M	0.0M	77.4M	8.3M	299.8M	150.0M	149.8M	149.9M	149.9M	219.8M	80.1M	298.2M	0.0M
tih_rna_sample_00054_23KKJ7LT4_1	167.2M	0.0M	0.0M	36.4M	3.4M	118.4M	59.3M	59.1M	59.2M	59.2M	98.8M	19.6M	117.9M	0.0M
tih_rna_sample_00056_23KKJ7LT4_1	626.4M	0.0M	0.0M	77.5M	5.5M	518.4M	259.4M	259.0M	259.2M	259.2M	362.3M	156.1M	516.2M	0.0M
tih_rna_sample_00057_23KKJ7LT4_1	109.6M	0.0M	0.0M	30.4M	3.4M	68.5M	34.3M	34.2M	34.2M	34.2M	51.4M	17.1M	68.2M	0.0M
tih_rna_sample_00058_23KKJ7LT4_1	678.1M	0.0M	0.0M	84.3M	10.8M	555.1M	277.7M	277.4M	277.6M	277.5M	365.6M	189.5M	553.1M	0.0M
tih_rna_sample_00060_23KKJ7LT4_1	520.6M	0.0M	0.0M	74.8M	5.7M	417.9M	209.1M	208.8M	208.9M	208.9M	321.4M	96.5M	416.5M	0.0M
tih_rna_sample_00061_23KKJ7LT4_1	664.9M	0.0M	0.0M	71.4M	6.5M	562.5M	281.4M	281.0M	281.2M	281.2M	349.1M	213.4M	560.2M	0.0M
tih_rna_sample_00063_23KKJ7LT4_1	692.9M	0.0M	0.0M	100.1M	7.5M	553.7M	277.0M	276.7M	276.9M	276.8M	361.4M	192.3M	551.6M	0.0M
tih_rna_sample_00064_23KKJ7LT4_1	656.4M	0.0M	0.0M	60.3M	4.3M	570.4M	285.3M	285.0M	285.2M	285.2M	347.0M	223.4M	568.1M	0.0M
tih_rna_sample_00066_23KKJ7LT4_1	656.1M	0.0M	0.0M	60.7M	4.8M	565.0M	282.6M	282.4M	282.5M	282.5M	331.7M	233.3M	563.1M	0.0M
tih_rna_sample_00068_23KKJ7LT4_1	661.0M	0.0M	0.0M	68.4M	5.5M	563.5M	281.9M	281.6M	281.8M	281.7M	373.7M	189.8M	561.5M	0.0M
tih_rna_sample_00070_23KKJ7LT4_1	653.8M	0.0M	0.0M	58.4M	6.9M	568.2M	284.3M	284.0M	284.1M	284.1M	350.7M	217.5M	566.2M	0.0M
tih_rna_sample_00071_23KKJ7LT4_1	747.7M	0.0M	0.0M	159.1M	13.3M	531.1M	265.8M	265.2M	265.6M	265.5M	366.2M	164.8M	528.7M	0.0M
tih_rna_sample_00072_23KKJ7LT4_1	658.6M	0.0M	0.0M	63.5M	4.6M	567.4M	283.8M	283.6M	283.7M	283.7M	351.0M	216.4M	565.6M	0.0M
tih_rna_sample_00073_23KKJ7LT4_1	614.4M	0.0M	0.0M	74.5M	6.3M	510.7M	255.5M	255.2M	255.4M	255.4M	372.8M	137.9M	508.6M	0.0M
tih_rna_sample_00074_23KKJ7LT4_1	653.9M	0.0M	0.0M	61.1M	4.4M	566.0M	283.2M	282.9M	283.0M	283.0M	327.7M	238.4M	564.2M	0.0M
tih_rna_sample_00077_23KKJ7LT4_1	747.7M	0.0M	0.0M	158.9M	12.2M	525.7M	263.1M	262.7M	262.9M	262.9M	363.1M	162.6M	523.8M	0.0M
tih_rna_sample_00078_23KKJ7LT4_1	656.6M	0.0M	0.0M	62.4M	4.5M	567.7M	283.9M	283.8M	283.9M	283.8M	361.0M	206.7M	566.0M	0.0M
tih_rna_sample_00079_23KKJ7LT4_1	676.2M	0.0M	0.0M	226.0M	14.1M	376.5M	188.4M	188.1M	188.2M	188.3M	264.1M	112.4M	375.2M	0.0M
tih_rna_sample_00080_23KKJ7LT4_1	599.6M	0.0M	0.0M	106.9M	7.8M	455.5M	228.0M	227.6M	227.8M	227.7M	334.4M	121.1M	453.9M	0.0M
tih_rna_sample_00081_23KKJ7LT4_1	663.9M	0.0M	0.0M	68.8M	5.7M	566.7M	283.5M	283.2M	283.4M	283.3M	357.4M	209.3M	564.6M	0.0M
tih_rna_sample_00082_23KKJ7LT4_1	668.8M	0.0M	0.0M	75.3M	4.9M	562.6M	281.5M	281.2M	281.3M	281.3M	360.2M	202.4M	561.0M	0.0M
tih_rna_sample_00083_23KKJ7LT4_1	669.2M	0.0M	0.0M	78.8M	5.1M	560.2M	280.2M	279.9M	280.1M	280.1M	354.9M	205.3M	558.3M	0.0M
tih_rna_sample_00084_23KKJ7LT4_1	437.6M	0.0M	0.0M	93.9M	6.1M	313.2M	156.8M	156.5M	156.6M	156.6M	250.4M	62.8M	311.9M	0.0M
tih_rna_sample_00086_23KKJ7LT4_1	685.7M	0.0M	0.0M	93.0M	8.0M	555.1M	277.8M	277.4M	277.6M	277.5M	354.1M	201.0M	553.2M	0.0M
tih_rna_sample_00170_23KKJ7LT4_1	647.9M	0.0M	0.0M	78.4M	5.7M	538.9M	269.6M	269.3M	269.5M	269.4M	443.4M	95.6M	536.5M	0.0M
tih_rna_sample_00176_23KKJ7LT4_1	694.0M	0.0M	0.0M	190.7M	11.8M	441.3M	220.9M	220.4M	220.7M	220.6M	326.3M	115.1M	439.2M	0.0M
tih_rna_sample_00179_23KKJ7LT4_1	731.1M	0.0M	0.0M	139.7M	8.3M	538.7M	269.6M	269.2M	269.4M	269.4M	351.7M	187.0M	536.7M	0.0M
tih_rna_sample_00180_23KKJ7LT4_1	757.8M	0.0M	0.0M	164.5M	12.3M	532.3M	266.3M	265.9M	266.1M	266.1M	353.1M	179.2M	529.9M	0.0M
tih_rna_sample_00183_23KKJ7LT4_1	710.6M	0.0M	0.0M	121.9M	8.6M	546.1M	273.2M	272.9M	273.1M	273.0M	388.1M	158.0M	543.5M	0.0M
tih_rna_sample_00184_23KKJ7LT4_1	700.0M	0.0M	0.0M	104.4M	7.9M	552.1M	276.3M	275.8M	276.1M	276.0M	363.1M	189.0M	549.7M	0.0M
tih_rna_sample_00185_23KKJ7LT4_1	663.2M	0.0M	0.0M	86.7M	8.3M	542.1M	271.3M	270.8M	271.1M	271.0M	410.6M	131.5M	539.8M	0.0M
tih_rna_sample_00186_23KKJ7LT4_1	660.9M	0.0M	0.0M	65.0M	5.2M	565.6M	282.9M	282.7M	282.8M	282.8M	337.6M	228.0M	563.7M	0.0M
tih_rna_sample_00198_23KKJ7LT4_1	593.6M	0.0M	0.0M	104.8M	6.7M	454.4M	227.4M	227.1M	227.2M	227.2M	331.5M	123.0M	452.2M	0.0M
tih_rna_sample_00200_23KKJ7LT4_1	283.1M	0.0M	0.0M	80.1M	6.0M	175.9M	88.0M	87.9M	87.9M	87.9M	137.8M	38.1M	175.2M	0.0M
tih_rna_sample_00202_23KKJ7LT4_1	657.2M	0.0M	0.0M	62.6M	5.8M	566.3M	283.2M	283.0M	283.1M	283.1M	372.2M	194.1M	564.2M	0.0M
tih_rna_sample_00204_23KKJ7LT4_1	24.2M	0.0M	0.0M	11.0M	1.6M	9.7M	4.8M	4.8M	4.8M	4.8M	8.7M	0.9M	9.6M	0.0M
tih_rna_sample_00206_23KKJ7LT4_1	658.1M	0.0M	0.0M	62.0M	5.4M	568.7M	284.4M	284.2M	284.4M	284.3M	354.2M	214.5M	566.5M	0.0M
tih_rna_sample_00207_23KKJ7LT4_1	703.0M	0.0M	0.0M	110.0M	8.1M	551.2M	275.7M	275.5M	275.6M	275.6M	396.3M	154.9M	549.1M	0.0M
tih_rna_sample_00208_23KKJ7LT4_1	655.0M	0.0M	0.0M	59.5M	4.0M	570.5M	285.4M	285.1M	285.3M	285.2M	358.3M	212.2M	568.1M	0.0M
tih_rna_sample_00216_23KKJ7LT4_1	164.2M	0.0M	0.0M	38.6M	2.6M	114.4M	57.2M	57.1M	57.2M	57.2M	91.0M	23.4M	113.8M	0.0M
tih_rna_sample_00219_23KKJ7LT4_1	689.2M	0.0M	0.0M	102.3M	7.5M	548.3M	274.4M	274.0M	274.2M	274.2M	370.7M	177.6M	546.4M	0.0M
tih_rna_sample_00223_23KKJ7LT4_1	670.0M	0.0M	0.0M	77.4M	4.6M	559.1M	279.7M	279.4M	279.6M	279.5M	322.1M	237.1M	557.2M	0.0M
tih_rna_sample_00224_23KKJ7LT4_1	710.4M	0.0M	0.0M	122.4M	7.0M	533.5M	266.9M	266.6M	266.7M	266.8M	365.8M	167.7M	531.6M	0.0M
tih_rna_sample_00225_23KKJ7LT4_1	660.3M	0.0M	0.0M	64.8M	4.8M	568.4M	284.3M	284.1M	284.2M	284.2M	368.1M	200.3M	566.3M	0.0M
tih_rna_sample_00226_23KKJ7LT4_1	867.9M	0.0M	0.0M	294.7M	20.6M	480.0M	240.3M	239.7M	240.1M	239.9M	310.4M	169.5M	477.7M	0.0M
tih_rna_sample_00234_23KKJ7LT4_1	675.0M	0.0M	0.0M	80.0M	6.6M	562.6M	281.5M	281.1M	281.3M	281.3M	370.2M	192.4M	560.1M	0.0M
tih_rna_sample_00239_23KKJ7LT4_1	647.9M	0.0M	0.0M	88.5M	7.2M	524.2M	262.3M	261.9M	262.1M	262.1M	375.4M	148.8M	522.2M	0.0M
tih_rna_sample_00243_23KKJ7LT4_1	698.8M	0.0M	0.0M	106.8M	7.0M	551.9M	276.2M	275.8M	276.0M	275.9M	371.6M	180.3M	549.9M	0.0M
tih_rna_sample_00244_23KKJ7LT4_1	657.7M	0.0M	0.0M	62.6M	5.3M	568.6M	284.4M	284.2M	284.3M	284.3M	353.6M	215.0M	566.7M	0.0M
tih_rna_sample_00245_23KKJ7LT4_1	662.7M	0.0M	0.0M	68.2M	7.5M	562.4M	281.4M	281.0M	281.2M	281.2M	351.9M	210.5M	560.6M	0.0M
tih_rna_sample_00247_23KKJ7LT4_1	531.1M	0.0M	0.0M	96.1M	6.9M	402.4M	201.4M	201.0M	201.2M	201.2M	322.5M	80.0M	400.8M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	192	373835390	0.3240%
GGGGCGGGGAGCGGGGCGTGGGCGGGAGGAGGGGAGGAGGCGTGGGGGGG	12	4479844	0.0039%
CCCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATT	10	3573265	0.0031%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	10	93947	0.0001%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	8	69966	0.0001%
GCGGGGCTCCGGGGGCGGGGAGCGGGGCGTGGGCGGGAGGAGGGGAGGAG	7	2524505	0.0022%
GGGGCTCCGGGGGCGGGGAGCGGGGCGTGGGCGGGAGGAGGGGAGGAGGC	6	2468834	0.0021%
GTCCGCGGGGCTCCGGGGGCGGGGAGCGGGGCGTGGGCGGGAGGAGGGGA	5	2347306	0.0020%
CGGGGCTCCGGGGGCGGGGAGCGGGGCGTGGGCGGGAGGAGGGGAGGAGG	4	1785405	0.0015%
CCCCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATAT	4	1046198	0.0009%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	4	12589	0.0000%
AACCGAAACCGAAACCTA	4	6550	0.0000%
TAGGTTTCGGTTTCGGTT	4	6544	0.0000%
GCTGCTGCCGGGGGGGC	4	2075	0.0000%
GCCCCCCCGGCAGCAGC	4	2029	0.0000%
GCTCCGGGGGCGGGGAGCGGGGCGTGGGCGGGAGGAGGGGAGGAGGCGTG	3	1054059	0.0009%
CGCGGGGCTCCGGGGGCGGGGAGCGGGGCGTGGGCGGGAGGAGGGGAGGA	3	898740	0.0008%
CCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTG	3	773701	0.0007%
GGCCCCCCCGGCAGCAGC	3	1711	0.0000%
GCTGCTGCCGGGGGGGCC	3	1715	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	96	60797236	0.1205%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	6	55915	0.0001%
CCCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATT	5	1629003	0.0032%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	5	43273	0.0001%
GGGGCGGGGAGCGGGGCGTGGGCGGGAGGAGGGGAGGAGGCGTGGGGGGG	4	1163548	0.0023%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	4	12589	0.0000%
AACCGAAACCGAAACCTA	4	6550	0.0000%
TAGGTTTCGGTTTCGGTT	4	6544	0.0000%
GCTGCTGCCGGGGGGGC	4	2075	0.0000%
GCCCCCCCGGCAGCAGC	4	2029	0.0000%
GGCCCCCCCGGCAGCAGC	3	1711	0.0000%
GCTGCTGCCGGGGGGGCC	3	1715	0.0000%
CCCGAGTGTTACAGCCCCCCCGGCAGCAGC	3	1596	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	3	1312	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGG	3	1601	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	3	1300	0.0000%
GTCCGCGGGGCTCCGGGGGCGGGGAGCGGGGCGTGGGCGGGAGGAGGGGA	2	917843	0.0018%
GGGGCTCCGGGGGCGGGGAGCGGGGCGTGGGCGGGAGGAGGGGAGGAGGC	2	796262	0.0016%
GCGGGGCTCCGGGGGCGGGGAGCGGGGCGTGGGCGGGAGGAGGGGAGGAG	2	834933	0.0017%
CCCCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATAT	2	509075	0.0010%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER	filter_arriba_main.py	`1.0`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CONTAMINATION_SKIPPED_LOW_READS	contamination_skipped_low_reads	`1.0.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PICARD_COLLECTINSERTSIZEMETRICS	picard	`3.1.0`
PICARD_COLLECTRNASEQMETRICS	picard	`null`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
SAMTOOLS_INDEX_ALIGNMENT_CRAM	samtools	`1.17`
SAMTOOLS_INDEX_STAR_ALIGNMENT	samtools	`1.17`
SAMTOOLS_VIEW_ALIGNMENT_CRAM	samtools	`1.17`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	boto3	`unknown`
	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_ALIGNMENT	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.0`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`3.0.2`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run /code/main.nf -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0006_exp0007/A23KKJ7LT4/nfcore_rnafusion__2cae617--20260513-145008' --project-dir /Users/anaik/Documents/Altera/rnafusion -profile docker,eks,std_run -name dev_rna_exp06_07-2cae617 --flowcell_id 20260107_LH00166_0227_A23KKJ7LT4 --rundir 's3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20260107_LH00166_0227_A23KKJ7LT4/' --bclconvert_samplesheet 's3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20260107_LH00166_0227_A23KKJ7LT4/bclconvert_samplesheet.csv' --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0006_exp0007/A23KKJ7LT4/nfcore_rnafusion__2cae617--20260513-145008'

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp06_07-2cae617
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /code
userName: nextflow
profile: docker,eks,std_run
configFiles: N/A

Input/output options

outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0006_exp0007/A23KKJ7LT4/nfcore_rnafusion__2cae617--20260513-145008
rundir: s3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20260107_LH00166_0227_A23KKJ7LT4/
flowcell_id: 20260107_LH00166_0227_A23KKJ7LT4
strand: reverse
bclconvert_samplesheet: s3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20260107_LH00166_0227_A23KKJ7LT4/bclconvert_samplesheet.csv
infer_sample_type_map: true
sample_type_map_positive_substring: HD789
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
starindex_ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
fastp_reads_to_process: 300000000
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Insert Size

Mark Duplicates Help

RnaSeqMetrics Assignment

Gene Coverage

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks