File Info

Filename
659_R1-T1-TRNA-1_B23MHV2LT4_1.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0009_exp0010/B23MHV2LT4/nfcore_rnafusion__04da504a--20260522-114016/fastp/659_R1-T1-TRNA-1_B23MHV2LT4_1.fastp.log
Size
1.5 KB
Published
May 22, 2026 12:47 PM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 500047
total bases: 75507097
Q20 bases: 66050326(87.4757%)
Q30 bases: 51725532(68.5042%)

Read2 before filtering:
total reads: 500047
total bases: 75507097
Q20 bases: 66879072(88.5732%)
Q30 bases: 47339111(62.6949%)

Read1 after filtering:
total reads: 69900
total bases: 3154511
Q20 bases: 3066380(97.2062%)
Q30 bases: 2870768(91.0052%)

Read2 after filtering:
total reads: 69900
total bases: 3314855
Q20 bases: 3244085(97.8651%)
Q30 bases: 3050162(92.0149%)

Filtering result:
reads passed filter: 139800
reads failed due to low quality: 102794
reads failed due to too many N: 8
reads failed due to too short: 757492
reads with adapter trimmed: 559761
bases trimmed due to adapters: 28701456

Duplication rate: 49.3334%

Insert size peak (evaluated by paired-end reads): 36

JSON report: 659_R1-T1-TRNA-1_B23MHV2LT4_1.fastp.json
HTML report: 659_R1-T1-TRNA-1_B23MHV2LT4_1.fastp.html

fastp --in1 659_R1-T1-TRNA-1_B23MHV2LT4_1_1.fastq.gz --in2 659_R1-T1-TRNA-1_B23MHV2LT4_1_2.fastq.gz --out1 659_R1-T1-TRNA-1_B23MHV2LT4_1_1.fastp.fastq.gz --out2 659_R1-T1-TRNA-1_B23MHV2LT4_1_2.fastp.fastq.gz --json 659_R1-T1-TRNA-1_B23MHV2LT4_1.fastp.json --html 659_R1-T1-TRNA-1_B23MHV2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 3 seconds