Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 192558 total bases: 29076258 Q20 bases: 25289590(86.9768%) Q30 bases: 19716259(67.8088%) Read2 before filtering: total reads: 192558 total bases: 29076258 Q20 bases: 27121292(93.2764%) Q30 bases: 20571225(70.7492%) Read1 after filtering: total reads: 22319 total bases: 1289996 Q20 bases: 1234824(95.7231%) Q30 bases: 1137792(88.2012%) Read2 after filtering: total reads: 22319 total bases: 1338456 Q20 bases: 1290401(96.4097%) Q30 bases: 1182606(88.356%) Filtering result: reads passed filter: 44638 reads failed due to low quality: 20760 reads failed due to too many N: 2 reads failed due to too short: 319716 reads with adapter trimmed: 209635 bases trimmed due to adapters: 9660305 Duplication rate: 53.964% Insert size peak (evaluated by paired-end reads): 36 JSON report: 659_cuO-T1-TRNA-1_B23MHV2LT4_1.fastp.json HTML report: 659_cuO-T1-TRNA-1_B23MHV2LT4_1.fastp.html fastp --in1 659_cuO-T1-TRNA-1_B23MHV2LT4_1_1.fastq.gz --in2 659_cuO-T1-TRNA-1_B23MHV2LT4_1_2.fastq.gz --out1 659_cuO-T1-TRNA-1_B23MHV2LT4_1_1.fastp.fastq.gz --out2 659_cuO-T1-TRNA-1_B23MHV2LT4_1_2.fastp.fastq.gz --json 659_cuO-T1-TRNA-1_B23MHV2LT4_1.fastp.json --html 659_cuO-T1-TRNA-1_B23MHV2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 fastp v0.23.4, time used: 4 seconds