MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-05-23, 02:47 UTC based on data in: /tmp/nxf.mvl5Lc2MXJ

General Statistics

Showing ⁴⁸⁰/₄₈₀ rows and ⁵⁵/₆₂ columns.

Sample Name	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	RNA contaminated	RNA contamination %	Reads	Frac Unmapped	Frac Dupes	Unique Reads	Frac Reads On Target	Frac Pairs On Target	Frac Reads Off Target	Frac Pairs Off Target	Reads On Target	Pairs On Target	Reads Off Target	Pairs Off Target	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	N Q30	GC Bias	Total Reads	Expected Distinct	Frag Length	% Aligned	M Aligned	Insert Size	Mean Insert Size	Duplication	rRNA	mRNA	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
659_1q-T1-TRNA-1_B23MHV2LT4_1	132.7bp	121.0bp	0.03%	1.23%	0.81%	0.00%	0.06%	3.50%	1.08%	0.00%	No	0.00%	591239618	0.01%	0.46%	321774584	0.94%	0.97%	0.05%	0.03%	303093411	152878058	15558836	5357108	560.01	243.00	0.71%	0.61%	0.97	0.000	9999000000	480850226				141bp	311bp	45.8%	0.0%	97.5%	89.4%	95.8%	283.2M	25.3%	97.0%	70109.4Mb	591.2M	53.1%	98.5%	63.8%
659_1q-T1-TRNA-1_B23MHV2LT4_1_1																																	132.7bp	98.3%	290.6M																86.9%	52%	151bp	151bp	27%	523.3M
659_1q-T1-TRNA-1_B23MHV2LT4_1_2																																																			85.8%	53%	151bp	151bp	18%	523.3M
659_1q-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			83.8%	52%	122bp	127bp	27%	295.6M	83.8%	52%	122bp	127bp	27%	295.6M
659_1q-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			83.6%	53%	122bp	127bp	18%	295.6M	83.6%	53%	122bp	127bp	18%	295.6M
659_6i-T1-TRNA-1_B23MHV2LT4_1	117.4bp	111.0bp	0.01%	1.45%	0.44%	0.00%	0.03%	4.28%	0.67%	0.00%	No	0.00%	425325108	0.01%	0.63%	158404277	0.91%	0.94%	0.07%	0.06%	144692587	72703032	10773583	4541406	222.32	106.00	0.69%	0.51%	0.97	0.000	9999000000	136094442				117bp	169bp	63.2%	0.0%	96.8%	87.5%	95.2%	202.4M	35.9%	97.2%	47674.9Mb	425.3M	54.4%	98.6%	78.5%
659_6i-T1-TRNA-1_B23MHV2LT4_1_1																																	117.4bp	97.8%	208.0M																81.9%	53%	151bp	151bp	18%	215.8M
659_6i-T1-TRNA-1_B23MHV2LT4_1_2																																																			80.2%	54%	151bp	151bp	18%	215.8M
659_6i-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			82.0%	54%	115bp	117bp	9%	212.7M	82.0%	54%	115bp	117bp	9%	212.7M
659_6i-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			81.3%	54%	115bp	117bp	9%	212.7M	81.3%	54%	115bp	117bp	9%	212.7M
659_8h-T1-TRNA-1_B23MHV2LT4_1	88.7bp	33.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	Skipped	N/A%	74016	0.17%	0.63%	27117	0.02%	0.04%	0.51%	0.96%	555	275	13962	6688	0.00	0.00	0.00%	0.00%	0.94	0.000	9999000000	41080				30bp	28bp	76.4%	0.7%	10.7%	1.6%	9.4%	0.0M	57.4%	91.0%	3.4Mb	0.1M	70.6%	13.0%	55.2%
659_8h-T1-TRNA-1_B23MHV2LT4_1_1																																	88.7bp	4.6%	0.0M																93.9%	73%	151bp	151bp	64%	0.3M
659_8h-T1-TRNA-1_B23MHV2LT4_1_2																																																			88.6%	93%	151bp	151bp	55%	0.3M
659_8h-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			62.3%	68%	49bp	37bp	45%	0.0M	62.3%	68%	49bp	37bp	45%	0.0M
659_8h-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			64.0%	73%	51bp	37bp	45%	0.0M	64.0%	73%	51bp	37bp	45%	0.0M
659_Dd-T1-TRNA-1_B23MHV2LT4_1	157.2bp	142.0bp	0.01%	0.94%	0.55%	0.00%	0.03%	3.04%	0.85%	0.00%	No	0.00%	591164484	0.01%	0.42%	344827360	0.95%	0.98%	0.04%	0.02%	326278866	165268555	14823245	4056469	693.95	336.00	0.75%	0.66%	0.97	0.000	9999000000	625681118				244bp	685bp	41.9%	0.0%	98.1%	90.8%	96.0%	283.9M	26.3%	97.0%	75874.9Mb	591.2M	54.7%	98.5%	46.7%
659_Dd-T1-TRNA-1_B23MHV2LT4_1_1																																	157.2bp	97.9%	289.5M																87.7%	54%	151bp	151bp	27%	625.9M
659_Dd-T1-TRNA-1_B23MHV2LT4_1_2																																																			86.4%	54%	151bp	151bp	18%	625.9M
659_Dd-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			83.6%	54%	132bp	151bp	27%	295.6M	83.6%	54%	132bp	151bp	27%	295.6M
659_Dd-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			83.2%	55%	132bp	151bp	18%	295.6M	83.2%	55%	132bp	151bp	18%	295.6M
659_Dl-T1-TRNA-1_B23MHV2LT4_1	119.7bp	112.0bp	0.02%	1.40%	0.46%	0.00%	0.05%	4.35%	0.73%	0.00%	No	0.00%	406134418	0.01%	0.57%	174812883	0.92%	0.95%	0.06%	0.05%	160363394	80538758	11126435	4573490	257.36	120.00	0.69%	0.53%	0.97	0.000	9990000000	161329455				119bp	177bp	57.4%	0.0%	97.0%	84.5%	93.9%	190.7M	31.3%	97.0%	45755.9Mb	406.1M	54.6%	98.4%	75.7%
659_Dl-T1-TRNA-1_B23MHV2LT4_1_1																																	119.7bp	97.7%	198.3M																79.9%	53%	151bp	151bp	27%	206.4M
659_Dl-T1-TRNA-1_B23MHV2LT4_1_2																																																			78.8%	54%	151bp	151bp	18%	206.4M
659_Dl-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			80.0%	54%	116bp	117bp	18%	203.1M	80.0%	54%	116bp	117bp	18%	203.1M
659_Dl-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			79.9%	54%	116bp	117bp	9%	203.1M	79.9%	54%	116bp	117bp	9%	203.1M
659_Fr-T1-TRNA-1_B23MHV2LT4_1	138.9bp	129.0bp	0.01%	1.10%	0.40%	0.00%	0.03%	3.73%	0.67%	0.00%	No	0.00%	592681722	0.01%	0.54%	271046876	0.94%	0.96%	0.05%	0.04%	253760609	128116504	14000949	5010490	480.88	247.00	0.77%	0.65%	0.97	0.000	9999000000	271228407				155bp	309bp	54.6%	0.0%	97.6%	88.0%	95.2%	282.0M	33.9%	97.3%	73851.8Mb	592.7M	54.9%	98.8%	59.6%
659_Fr-T1-TRNA-1_B23MHV2LT4_1_1																																	138.9bp	98.3%	291.4M																84.9%	54%	151bp	151bp	18%	391.4M
659_Fr-T1-TRNA-1_B23MHV2LT4_1_2																																																			83.7%	54%	151bp	151bp	18%	391.4M
659_Fr-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			82.8%	54%	128bp	137bp	9%	296.3M	82.8%	54%	128bp	137bp	9%	296.3M
659_Fr-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			82.5%	55%	128bp	137bp	9%	296.3M	82.5%	55%	128bp	137bp	9%	296.3M
659_Kh-T1-TRNA-1_B23MHV2LT4_1	173.5bp	153.0bp	0.01%	0.94%	0.26%	0.00%	0.03%	2.94%	0.44%	0.00%	Skipped	N/A%	6186588	0.01%	0.83%	1060115	0.86%	0.92%	0.10%	0.08%	909457	461327	105440	38514	1.83	0.00	0.00%	0.00%	0.97	0.000	9999000000	1238895				220bp	597bp	83.5%	0.0%	97.3%	81.7%	94.6%	2.9M	62.8%	96.9%	796.2Mb	6.2M	54.0%	90.1%	44.9%
659_Kh-T1-TRNA-1_B23MHV2LT4_1_1																																	173.5bp	96.7%	3.0M																83.6%	55%	151bp	151bp	45%	3.4M
659_Kh-T1-TRNA-1_B23MHV2LT4_1_2																																																			81.2%	58%	151bp	151bp	45%	3.4M
659_Kh-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			82.1%	53%	133bp	151bp	18%	3.1M	82.1%	53%	133bp	151bp	18%	3.1M
659_Kh-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			81.2%	54%	133bp	151bp	9%	3.1M	81.2%	54%	133bp	151bp	9%	3.1M
659_Lx-T1-TRNA-1_B23MHV2LT4_1	117.8bp	109.0bp	0.02%	1.11%	0.35%	0.00%	0.04%	3.44%	0.55%	0.00%	No	0.00%	535799734	0.01%	0.51%	261276582	0.94%	0.96%	0.05%	0.04%	244860371	123014335	13721147	5393501	400.54	187.00	0.73%	0.60%	0.97	0.000	9999000000	343152179				114bp	187bp	51.5%	0.0%	97.7%	88.7%	95.8%	256.6M	23.9%	96.9%	59050.6Mb	535.8M	53.4%	98.5%	77.1%
659_Lx-T1-TRNA-1_B23MHV2LT4_1_1																																	117.8bp	98.2%	263.0M																80.3%	52%	151bp	151bp	27%	271.9M
659_Lx-T1-TRNA-1_B23MHV2LT4_1_2																																																			79.0%	53%	151bp	151bp	18%	271.9M
659_Lx-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			80.4%	53%	114bp	112bp	18%	267.9M	80.4%	53%	114bp	112bp	18%	267.9M
659_Lx-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			80.1%	53%	114bp	112bp	9%	267.9M	80.1%	53%	114bp	112bp	9%	267.9M
659_Mt-T1-TRNA-1_B23MHV2LT4_1	128.9bp	122.0bp	0.01%	0.87%	0.33%	0.00%	0.02%	2.71%	0.51%	0.00%	No	0.00%	592733494	0.01%	0.60%	236834191	0.93%	0.95%	0.06%	0.05%	219085701	110367747	13978863	5501150	386.47	178.00	0.72%	0.60%	0.97	0.000	9999000000	216547077				135bp	227bp	60.4%	0.0%	97.3%	86.5%	94.8%	280.9M	36.2%	97.3%	71266.9Mb	592.7M	54.1%	98.8%	67.7%
659_Mt-T1-TRNA-1_B23MHV2LT4_1_1																																	128.9bp	97.8%	290.0M																84.3%	53%	151bp	151bp	27%	307.5M
659_Mt-T1-TRNA-1_B23MHV2LT4_1_2																																																			83.5%	53%	151bp	151bp	18%	307.5M
659_Mt-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			84.2%	53%	124bp	127bp	27%	296.4M	84.2%	53%	124bp	127bp	27%	296.4M
659_Mt-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			84.3%	54%	124bp	127bp	9%	296.4M	84.3%	54%	124bp	127bp	9%	296.4M
659_On-T1-TRNA-2_B23MHV2LT4_1	141.3bp	129.0bp	0.02%	2.02%	0.60%	0.00%	0.04%	5.84%	0.91%	0.00%	No	0.00%	591153756	0.00%	0.47%	312898864	0.94%	0.96%	0.05%	0.04%	293147797	148033187	16964901	5937717	560.82	233.00	0.70%	0.60%	0.97	0.000	9999000000	393848015				157bp	328bp	47.3%	0.0%	96.7%	89.7%	95.8%	283.2M	29.2%	97.0%	72723.9Mb	591.2M	54.4%	98.5%	57.8%
659_On-T1-TRNA-2_B23MHV2LT4_1_1																																	141.3bp	98.0%	289.8M																84.6%	53%	151bp	151bp	27%	336.3M
659_On-T1-TRNA-2_B23MHV2LT4_1_2																																																			83.6%	54%	151bp	151bp	18%	336.3M
659_On-T1-TRNA-2_B23MHV2LT4_1_trimmed_1																																																			83.9%	54%	127bp	137bp	18%	295.6M	83.9%	54%	127bp	137bp	18%	295.6M
659_On-T1-TRNA-2_B23MHV2LT4_1_trimmed_2																																																			83.9%	54%	127bp	137bp	18%	295.6M	83.9%	54%	127bp	137bp	18%	295.6M
659_R1-T1-TRNA-1_B23MHV2LT4_1	113.7bp	49.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	Skipped	N/A%	139800	0.14%	0.72%	39590	0.02%	0.03%	0.50%	0.97%	714	335	19790	9396	0.00	0.00	0.00%	0.00%	0.95	0.000	9999000000	56011				32bp	29bp	83.0%	0.9%	8.1%	1.1%	7.3%	0.0M	49.3%	91.5%	5.9Mb	0.1M	71.3%	14.0%	56.0%
659_R1-T1-TRNA-1_B23MHV2LT4_1_1																																	113.7bp	3.7%	0.0M																94.5%	72%	151bp	151bp	64%	0.5M
659_R1-T1-TRNA-1_B23MHV2LT4_1_2																																																			85.9%	92%	151bp	151bp	55%	0.5M
659_R1-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			67.9%	69%	45bp	37bp	45%	0.1M	67.9%	69%	45bp	37bp	45%	0.1M
659_R1-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			69.0%	73%	48bp	37bp	45%	0.1M	69.0%	73%	48bp	37bp	45%	0.1M
659_SP-T1-TRNA-1_B23MHV2LT4_1	135.4bp	126.0bp	0.01%	1.10%	0.41%	0.00%	0.03%	3.51%	0.64%	0.00%	No	0.00%	592710364	0.01%	0.47%	311209134	0.94%	0.96%	0.05%	0.04%	291898511	147198836	15543849	5688900	537.70	293.00	0.77%	0.67%	0.97	0.000	9990000000	400234251				146bp	302bp	47.8%	0.0%	97.4%	89.5%	95.7%	283.5M	27.6%	97.3%	72315.3Mb	592.7M	53.5%	98.8%	63.4%
659_SP-T1-TRNA-1_B23MHV2LT4_1_1																																	135.4bp	98.0%	290.3M																83.2%	52%	151bp	151bp	18%	402.2M
659_SP-T1-TRNA-1_B23MHV2LT4_1_2																																																			82.4%	53%	151bp	151bp	18%	402.2M
659_SP-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			81.0%	53%	125bp	132bp	18%	296.4M	81.0%	53%	125bp	132bp	18%	296.4M
659_SP-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			81.0%	53%	125bp	132bp	9%	296.4M	81.0%	53%	125bp	132bp	9%	296.4M
659_Wm-T1-TRNA-1_B23MHV2LT4_1	94.8bp	31.0bp	0.00%	0.05%	0.00%	0.00%	0.00%	0.13%	0.00%	0.00%	Skipped	N/A%	60974	0.19%	0.63%	22517	0.02%	0.03%	0.46%	0.97%	361	172	10370	4902	0.00	0.00	0.00%	0.00%	0.93	0.000	9999000000	40836				32bp	30bp	78.2%	0.4%	11.8%	1.3%	8.0%	0.0M	49.1%	88.1%	3.1Mb	0.1M	72.1%	8.4%	53.0%
659_Wm-T1-TRNA-1_B23MHV2LT4_1_1																																	94.8bp	6.6%	0.0M																95.7%	73%	151bp	151bp	55%	0.4M
659_Wm-T1-TRNA-1_B23MHV2LT4_1_2																																																			90.0%	96%	151bp	151bp	55%	0.4M
659_Wm-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			61.4%	68%	56bp	37bp	45%	0.0M	61.4%	68%	56bp	37bp	45%	0.0M
659_Wm-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			63.5%	75%	59bp	37bp	55%	0.0M	63.5%	75%	59bp	37bp	55%	0.0M
659_b4x-T1-TRNA-1_B23MHV2LT4_1	109.4bp	106.0bp	0.01%	0.85%	0.40%	0.00%	0.02%	2.56%	0.65%	0.00%	No	0.00%	143507566	0.01%	0.85%	21939939	0.81%	0.87%	0.13%	0.13%	17754026	8894362	2867590	1320413	23.29	7.00	0.21%	0.04%	0.97	0.000	9999000000	24943325				108bp	132bp	85.5%	0.0%	96.7%	83.3%	94.2%	67.6M	45.7%	97.2%	15257.4Mb	143.5M	57.7%	98.4%	85.8%
659_b4x-T1-TRNA-1_B23MHV2LT4_1_1																																	109.4bp	97.1%	69.7M																85.8%	55%	151bp	151bp	18%	72.9M
659_b4x-T1-TRNA-1_B23MHV2LT4_1_2																																																			84.7%	57%	151bp	151bp	27%	72.9M
659_b4x-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			85.9%	57%	109bp	107bp	9%	71.8M	85.9%	57%	109bp	107bp	9%	71.8M
659_b4x-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			85.8%	57%	110bp	107bp	9%	71.8M	85.8%	57%	110bp	107bp	9%	71.8M
659_b6o-T1-TRNA-1_B23MHV2LT4_1	99.8bp	113.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	Skipped	N/A%	75922	0.19%	0.62%	28477	0.02%	0.04%	0.46%	0.96%	563	274	13188	6284	0.00	0.00	0.00%	0.00%	0.95	0.000	9999000000	37526				31bp	28bp	77.5%	0.9%	12.1%	1.6%	9.4%	0.0M	49.7%	90.3%	3.6Mb	0.1M	72.0%	8.7%	53.3%
659_b6o-T1-TRNA-1_B23MHV2LT4_1_1																																	99.8bp	4.8%	0.0M																95.7%	74%	151bp	151bp	64%	0.4M
659_b6o-T1-TRNA-1_B23MHV2LT4_1_2																																																			86.7%	94%	151bp	151bp	55%	0.4M
659_b6o-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			61.7%	68%	51bp	37bp	45%	0.0M	61.7%	68%	51bp	37bp	45%	0.0M
659_b6o-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			63.7%	75%	54bp	37bp	45%	0.0M	63.7%	75%	54bp	37bp	45%	0.0M
659_b7Z-T1-TRNA-1_B23MHV2LT4_1	158.2bp	144.0bp	0.03%	1.24%	0.49%	0.00%	0.05%	3.57%	0.69%	0.00%	No	0.00%	592632988	0.01%	0.44%	332867696	0.94%	0.97%	0.05%	0.03%	313918187	159171956	15051388	4418007	659.51	308.00	0.76%	0.66%	0.97	0.000	9999000000	478690140				219bp	616bp	44.1%	0.0%	97.8%	87.5%	94.8%	280.8M	29.9%	97.3%	77408.3Mb	592.6M	53.8%	98.8%	46.7%
659_b7Z-T1-TRNA-1_B23MHV2LT4_1_1																																	158.2bp	98.2%	291.0M																87.1%	53%	151bp	151bp	18%	522.3M
659_b7Z-T1-TRNA-1_B23MHV2LT4_1_2																																																			86.3%	53%	151bp	151bp	18%	522.3M
659_b7Z-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			83.8%	53%	134bp	151bp	9%	296.3M	83.8%	53%	134bp	151bp	9%	296.3M
659_b7Z-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			83.9%	54%	134bp	151bp	9%	296.3M	83.9%	54%	134bp	151bp	9%	296.3M
659_bCu-T1-TRNA-1_B23MHV2LT4_1	118.4bp	112.0bp	0.00%	0.63%	0.27%	0.00%	0.00%	2.05%	0.43%	0.00%	No	0.00%	510617944	0.01%	0.74%	130517564	0.88%	0.92%	0.09%	0.08%	115501519	58043218	11201465	4856999	178.36	48.00	0.57%	0.37%	0.97	0.000	9999000000	125736775				119bp	165bp	75.0%	0.0%	96.9%	87.3%	95.2%	242.9M	44.1%	97.1%	57811.6Mb	510.6M	59.1%	98.6%	77.3%
659_bCu-T1-TRNA-1_B23MHV2LT4_1_1																																	118.4bp	97.7%	249.4M																86.9%	57%	151bp	151bp	18%	258.8M
659_bCu-T1-TRNA-1_B23MHV2LT4_1_2																																																			85.9%	57%	151bp	151bp	18%	258.8M
659_bCu-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			87.0%	58%	117bp	117bp	9%	255.3M	87.0%	58%	117bp	117bp	9%	255.3M
659_bCu-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			86.9%	59%	117bp	117bp	9%	255.3M	86.9%	59%	117bp	117bp	9%	255.3M
659_bGW-T1-TRNA-1_B23MHV2LT4_1	127.6bp	116.0bp	0.04%	1.41%	0.67%	0.00%	0.09%	4.43%	0.98%	0.00%	Yes	0.00%	591208932	0.01%	0.48%	307574947	0.95%	0.97%	0.04%	0.03%	290753249	146455890	13585183	4647272	520.76	237.00	0.74%	0.63%	0.97	0.000	9990000000	433885931				135bp	281bp	48.2%	0.0%	98.1%	87.5%	95.0%	280.7M	25.5%	97.0%	68498.8Mb	591.2M	54.8%	98.5%	68.0%
659_bGW-T1-TRNA-1_B23MHV2LT4_1_1																																	127.6bp	98.4%	291.0M																86.1%	53%	151bp	151bp	27%	467.5M
659_bGW-T1-TRNA-1_B23MHV2LT4_1_2																																																			85.0%	54%	151bp	151bp	18%	467.5M
659_bGW-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			83.4%	54%	119bp	122bp	27%	295.6M	83.4%	54%	119bp	122bp	27%	295.6M
659_bGW-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			83.2%	55%	120bp	122bp	18%	295.6M	83.2%	55%	120bp	122bp	18%	295.6M
659_bGc-T1-TRNA-1_B23MHV2LT4_1	119.2bp	110.0bp	0.02%	1.01%	0.39%	0.00%	0.04%	2.94%	0.57%	0.00%	Yes	0.00%	590445544	0.01%	0.56%	259749431	0.93%	0.96%	0.05%	0.04%	242445636	121881178	13995478	5385239	397.66	197.00	0.75%	0.62%	0.97	0.000	9999000000	259949497				117bp	198bp	56.3%	0.0%	97.5%	89.6%	95.9%	283.1M	28.6%	97.0%	65719.8Mb	590.4M	54.5%	98.4%	75.0%
659_bGc-T1-TRNA-1_B23MHV2LT4_1_1																																	119.2bp	98.3%	290.2M																84.0%	53%	151bp	151bp	27%	340.7M
659_bGc-T1-TRNA-1_B23MHV2LT4_1_2																																																			82.5%	54%	151bp	151bp	27%	340.7M
659_bGc-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			83.0%	54%	115bp	117bp	18%	295.2M	83.0%	54%	115bp	117bp	18%	295.2M
659_bGc-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			82.7%	54%	115bp	117bp	18%	295.2M	82.7%	54%	115bp	117bp	18%	295.2M
659_bIB-T1-TRNA-1_B23MHV2LT4_1	153.1bp	140.0bp	0.02%	1.25%	0.76%	0.00%	0.04%	3.95%	1.11%	0.00%	Yes	0.07%	592872992	0.01%	0.42%	343718490	0.95%	0.97%	0.04%	0.03%	325846628	164985080	14531508	4274893	679.21	301.00	0.74%	0.64%	0.97	0.000	9999000000	560211138				217bp	591bp	42.3%	0.0%	98.1%	88.5%	95.2%	282.1M	28.9%	97.3%	76725.2Mb	592.9M	54.4%	98.8%	49.1%
659_bIB-T1-TRNA-1_B23MHV2LT4_1_1																																	153.1bp	98.3%	291.4M																86.6%	53%	151bp	151bp	18%	373.2M
659_bIB-T1-TRNA-1_B23MHV2LT4_1_2																																																			85.5%	54%	151bp	151bp	18%	373.2M
659_bIB-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			85.4%	54%	133bp	151bp	9%	296.4M	85.4%	54%	133bp	151bp	9%	296.4M
659_bIB-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			85.1%	54%	133bp	151bp	9%	296.4M	85.1%	54%	133bp	151bp	9%	296.4M
659_bKP-T1-TRNA-1_B23MHV2LT4_1	132.4bp	125.0bp	0.01%	1.33%	0.63%	0.00%	0.03%	3.76%	0.86%	0.00%	No	0.00%	591933030	0.01%	0.60%	239492769	0.93%	0.96%	0.05%	0.04%	223067718	112431558	12789382	4788124	393.14	176.00	0.70%	0.58%	0.97	0.000	9999000000	217651480				143bp	275bp	59.9%	0.0%	97.4%	86.7%	94.6%	280.0M	37.2%	97.3%	72107.7Mb	591.9M	54.4%	98.7%	65.9%
659_bKP-T1-TRNA-1_B23MHV2LT4_1_1																																	132.4bp	97.4%	288.4M																83.2%	53%	151bp	151bp	18%	314.0M
659_bKP-T1-TRNA-1_B23MHV2LT4_1_2																																																			82.4%	54%	151bp	151bp	18%	314.0M
659_bKP-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			82.9%	54%	125bp	132bp	9%	296.0M	82.9%	54%	125bp	132bp	9%	296.0M
659_bKP-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			83.0%	54%	125bp	132bp	9%	296.0M	83.0%	54%	125bp	132bp	9%	296.0M
659_bMa-T1-TRNA-1_B23MHV2LT4_1	114.6bp	109.0bp	0.01%	1.15%	0.49%	0.00%	0.03%	3.50%	0.74%	0.00%	No	0.00%	323123520	0.01%	0.87%	41081533	0.78%	0.86%	0.14%	0.14%	31917795	16011739	5810347	2655133	44.64	15.00	0.35%	0.11%	0.97	0.000	9990000000	47921299				117bp	166bp	88.2%	0.0%	96.8%	81.9%	93.3%	150.8M	51.4%	97.0%	35799.0Mb	323.1M	57.5%	98.5%	81.0%
659_bMa-T1-TRNA-1_B23MHV2LT4_1_1																																	114.6bp	97.3%	157.2M																89.7%	55%	151bp	151bp	18%	164.1M
659_bMa-T1-TRNA-1_B23MHV2LT4_1_2																																																			88.4%	56%	151bp	151bp	18%	164.1M
659_bMa-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			89.8%	57%	114bp	112bp	9%	161.6M	89.8%	57%	114bp	112bp	9%	161.6M
659_bMa-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			89.5%	57%	114bp	112bp	9%	161.6M	89.5%	57%	114bp	112bp	9%	161.6M
659_bNS-T1-TRNA-1_B23MHV2LT4_1	138.7bp	127.0bp	0.02%	1.45%	0.57%	0.00%	0.04%	4.26%	0.85%	0.00%	No	0.00%	590932886	0.01%	0.45%	322293685	0.94%	0.97%	0.05%	0.03%	303901814	153398161	15020949	4981889	581.30	287.00	0.77%	0.66%	0.97	0.000	9999000000	474984202				162bp	388bp	45.7%	0.0%	97.7%	89.6%	95.6%	282.3M	27.1%	97.0%	72197.8Mb	590.9M	54.7%	98.5%	59.8%
659_bNS-T1-TRNA-1_B23MHV2LT4_1_1																																	138.7bp	98.3%	290.5M																84.9%	53%	151bp	151bp	27%	398.4M
659_bNS-T1-TRNA-1_B23MHV2LT4_1_2																																																			84.1%	54%	151bp	151bp	18%	398.4M
659_bNS-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			83.0%	54%	126bp	137bp	27%	295.5M	83.0%	54%	126bp	137bp	27%	295.5M
659_bNS-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			83.3%	55%	126bp	137bp	18%	295.5M	83.3%	55%	126bp	137bp	18%	295.5M
659_bQZ-T1-TRNA-1_B23MHV2LT4_1	144.6bp	136.0bp	0.01%	1.53%	0.62%	0.00%	0.02%	4.61%	0.95%	0.00%	No	0.00%	591930432	0.01%	0.55%	267369644	0.93%	0.97%	0.05%	0.03%	248607938	125632037	13290576	4549888	480.75	217.00	0.74%	0.62%	0.97	0.000	9999000000	266805737				174bp	368bp	55.3%	0.0%	97.4%	88.2%	95.0%	281.0M	36.5%	97.1%	75355.9Mb	591.9M	56.6%	98.7%	55.2%
659_bQZ-T1-TRNA-1_B23MHV2LT4_1_1																																	144.6bp	97.9%	289.8M																86.3%	55%	151bp	151bp	18%	423.2M
659_bQZ-T1-TRNA-1_B23MHV2LT4_1_2																																																			85.3%	56%	151bp	151bp	18%	423.2M
659_bQZ-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			83.9%	56%	131bp	142bp	9%	296.0M	83.9%	56%	131bp	142bp	9%	296.0M
659_bQZ-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			83.9%	56%	131bp	142bp	9%	296.0M	83.9%	56%	131bp	142bp	9%	296.0M
659_bR4-T1-TRNA-1_B23MHV2LT4_1	136.3bp	125.0bp	0.01%	1.06%	0.56%	0.00%	0.01%	3.30%	0.80%	0.00%	No	0.00%	581642334	0.01%	0.40%	347364543	0.93%	0.96%	0.06%	0.04%	324067234	163423144	19583253	7235467	603.49	361.00	0.81%	0.71%	0.97	0.000	9999000000	523947377				143bp	271bp	40.5%	0.0%	96.6%	88.0%	95.1%	276.5M	24.1%	96.9%	70484.0Mb	581.6M	54.9%	98.4%	61.2%
659_bR4-T1-TRNA-1_B23MHV2LT4_1_1																																	136.3bp	97.6%	283.8M																80.6%	53%	151bp	151bp	27%	295.5M
659_bR4-T1-TRNA-1_B23MHV2LT4_1_2																																																			79.9%	54%	151bp	151bp	18%	295.5M
659_bR4-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			80.7%	54%	125bp	132bp	18%	290.8M	80.7%	54%	125bp	132bp	18%	290.8M
659_bR4-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			81.1%	55%	125bp	132bp	9%	290.8M	81.1%	55%	125bp	132bp	9%	290.8M
659_bTo-T1-TRNA-1_B23MHV2LT4_1	142.8bp	131.0bp	0.01%	0.83%	0.77%	0.00%	0.02%	2.63%	1.13%	0.00%	No	0.00%	592370550	0.00%	0.50%	294063113	0.95%	0.98%	0.04%	0.02%	279777260	141367309	11790828	3576113	550.23	206.00	0.71%	0.60%	0.97	0.000	9999000000	377738035				194bp	511bp	50.6%	0.0%	98.3%	92.7%	96.8%	286.6M	32.5%	97.3%	74021.8Mb	592.4M	55.1%	98.7%	56.9%
659_bTo-T1-TRNA-1_B23MHV2LT4_1_1																																	142.8bp	98.7%	292.4M																86.5%	54%	151bp	151bp	18%	343.1M
659_bTo-T1-TRNA-1_B23MHV2LT4_1_2																																																			85.6%	55%	151bp	151bp	18%	343.1M
659_bTo-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			85.7%	54%	128bp	142bp	9%	296.2M	85.7%	54%	128bp	142bp	9%	296.2M
659_bTo-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			85.8%	55%	129bp	142bp	9%	296.2M	85.8%	55%	129bp	142bp	9%	296.2M
659_bTq-T1-TRNA-1_B23MHV2LT4_1	146.8bp	131.0bp	0.03%	1.57%	0.58%	0.00%	0.08%	4.71%	0.87%	0.00%	No	0.00%	591221520	0.01%	0.44%	330271462	0.94%	0.97%	0.05%	0.03%	309740610	156830583	16769237	5251770	623.95	291.00	0.76%	0.66%	0.97	0.000	9999000000	512868926				177bp	457bp	44.4%	0.0%	97.3%	88.7%	95.7%	282.8M	27.7%	97.1%	73433.3Mb	591.2M	52.9%	98.5%	53.4%
659_bTq-T1-TRNA-1_B23MHV2LT4_1_1																																	146.8bp	98.0%	289.6M																88.0%	52%	151bp	151bp	27%	554.7M
659_bTq-T1-TRNA-1_B23MHV2LT4_1_2																																																			86.4%	53%	151bp	151bp	18%	554.7M
659_bTq-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			84.7%	52%	128bp	142bp	27%	295.6M	84.7%	52%	128bp	142bp	27%	295.6M
659_bTq-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			83.9%	53%	128bp	142bp	18%	295.6M	83.9%	53%	128bp	142bp	18%	295.6M
659_bUW-T1-TRNA-1_B23MHV2LT4_1	143.6bp	129.0bp	0.03%	1.62%	0.64%	0.00%	0.06%	4.97%	0.99%	0.00%	Yes	0.00%	590986270	0.01%	0.44%	333294529	0.95%	0.97%	0.04%	0.03%	315824344	159476405	13658270	4131891	633.04	248.00	0.71%	0.61%	0.97	0.000	9999000000	609559090				166bp	408bp	43.9%	0.0%	98.4%	80.3%	91.8%	271.2M	25.4%	97.0%	73180.2Mb	591.0M	54.0%	98.5%	55.9%
659_bUW-T1-TRNA-1_B23MHV2LT4_1_1																																	143.6bp	98.5%	291.2M																88.2%	53%	151bp	151bp	27%	771.7M
659_bUW-T1-TRNA-1_B23MHV2LT4_1_2																																																			87.2%	54%	151bp	151bp	18%	771.7M
659_bUW-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			83.0%	53%	128bp	142bp	27%	295.5M	83.0%	53%	128bp	142bp	27%	295.5M
659_bUW-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			83.3%	54%	128bp	142bp	18%	295.5M	83.3%	54%	128bp	142bp	18%	295.5M
659_bUs-T1-TRNA-1_B23MHV2LT4_1	168.9bp	152.0bp	0.02%	1.76%	0.46%	0.00%	0.04%	5.33%	0.72%	0.00%	No	0.00%	592335092	0.00%	0.41%	349677039	0.95%	0.98%	0.04%	0.02%	331647146	168268900	15374963	4234436	729.85	339.00	0.77%	0.67%	0.97	0.000	9999000000	573304928				282bp	915bp	41.2%	0.0%	98.2%	91.6%	96.4%	285.4M	29.6%	97.3%	78664.1Mb	592.3M	53.3%	98.7%	41.2%
659_bUs-T1-TRNA-1_B23MHV2LT4_1_1																																	168.9bp	98.4%	291.5M																87.6%	52%	151bp	151bp	18%	474.9M
659_bUs-T1-TRNA-1_B23MHV2LT4_1_2																																																			86.5%	53%	151bp	151bp	18%	474.9M
659_bUs-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			85.1%	52%	136bp	151bp	9%	296.2M	85.1%	52%	136bp	151bp	9%	296.2M
659_bUs-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			84.8%	53%	137bp	151bp	9%	296.2M	84.8%	53%	137bp	151bp	9%	296.2M
659_bhK-T1-TRNA-1_B23MHV2LT4_1	140.7bp	129.0bp	0.01%	0.65%	0.40%	0.00%	0.03%	2.37%	0.71%	0.00%	No	0.00%	590560028	0.01%	0.52%	281777818	0.94%	0.97%	0.05%	0.03%	264742682	133629311	13495551	4503451	514.36	231.00	0.74%	0.63%	0.97	0.000	9999000000	468261063				189bp	467bp	52.6%	0.0%	97.6%	91.2%	96.2%	284.2M	31.6%	97.0%	72616.5Mb	590.6M	55.5%	98.4%	57.7%
659_bhK-T1-TRNA-1_B23MHV2LT4_1_1																																	140.7bp	98.4%	290.4M																86.7%	54%	151bp	151bp	27%	504.7M
659_bhK-T1-TRNA-1_B23MHV2LT4_1_2																																																			85.9%	55%	151bp	151bp	18%	504.7M
659_bhK-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			83.7%	55%	127bp	137bp	27%	295.3M	83.7%	55%	127bp	137bp	27%	295.3M
659_bhK-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			84.0%	55%	127bp	137bp	18%	295.3M	84.0%	55%	127bp	137bp	18%	295.3M
659_bjQ-T1-TRNA-1_B23MHV2LT4_1	134.6bp	124.0bp	0.02%	0.61%	0.48%	0.00%	0.04%	2.05%	0.75%	0.00%	Yes	0.00%	591173518	0.01%	0.46%	319819884	0.94%	0.96%	0.05%	0.04%	299739552	151074733	16035857	5692883	561.49	284.00	0.77%	0.66%	0.97	0.000	9999000000	476123431				148bp	304bp	46.2%	0.0%	97.4%	89.3%	95.7%	282.8M	26.1%	96.9%	71208.4Mb	591.2M	54.4%	98.5%	62.7%
659_bjQ-T1-TRNA-1_B23MHV2LT4_1_1																																	134.6bp	98.2%	290.3M																83.3%	53%	151bp	151bp	27%	355.2M
659_bjQ-T1-TRNA-1_B23MHV2LT4_1_2																																																			82.0%	54%	151bp	151bp	18%	355.2M
659_bjQ-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			82.2%	54%	124bp	132bp	18%	295.6M	82.2%	54%	124bp	132bp	18%	295.6M
659_bjQ-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			81.9%	54%	124bp	132bp	18%	295.6M	81.9%	54%	124bp	132bp	18%	295.6M
659_buD-T1-TRNA-1_B23MHV2LT4_1	131.5bp	120.0bp	0.03%	1.17%	0.61%	0.00%	0.06%	3.53%	0.91%	0.00%	Yes	0.00%	591474434	0.01%	0.43%	339248595	0.94%	0.97%	0.05%	0.03%	318956908	160775338	16431641	5798906	582.78	304.00	0.77%	0.67%	0.97	0.000	9999000000	526347461				146bp	323bp	42.9%	0.0%	97.5%	89.2%	95.5%	282.4M	23.6%	97.1%	70265.6Mb	591.5M	53.8%	98.6%	64.7%
659_buD-T1-TRNA-1_B23MHV2LT4_1_1																																	131.5bp	98.2%	290.3M																82.8%	52%	151bp	151bp	27%	404.9M
659_buD-T1-TRNA-1_B23MHV2LT4_1_2																																																			82.9%	53%	151bp	151bp	18%	404.9M
659_buD-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			80.7%	53%	122bp	127bp	27%	295.7M	80.7%	53%	122bp	127bp	27%	295.7M
659_buD-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			81.8%	54%	122bp	127bp	18%	295.7M	81.8%	54%	122bp	127bp	18%	295.7M
659_bua-T1-TRNA-1_B23MHV2LT4_1	133.9bp	124.0bp	0.01%	0.80%	0.60%	0.00%	0.02%	2.55%	0.88%	0.00%	No	0.00%	592154192	0.00%	0.51%	289973341	0.94%	0.97%	0.05%	0.03%	273080246	137833357	13940229	4900376	506.99	196.00	0.69%	0.59%	0.97	0.000	9999000000	361326949				154bp	338bp	51.3%	0.0%	97.5%	91.4%	96.4%	285.3M	32.0%	97.2%	71965.5Mb	592.2M	54.2%	98.7%	62.6%
659_bua-T1-TRNA-1_B23MHV2LT4_1_1																																	133.9bp	98.3%	291.0M																86.5%	53%	151bp	151bp	18%	470.4M
659_bua-T1-TRNA-1_B23MHV2LT4_1_2																																																			85.8%	54%	151bp	151bp	18%	470.4M
659_bua-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			83.6%	53%	125bp	132bp	9%	296.1M	83.6%	53%	125bp	132bp	9%	296.1M
659_bua-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			83.8%	54%	125bp	132bp	9%	296.1M	83.8%	54%	125bp	132bp	9%	296.1M
659_buj-T1-TRNA-1_B23MHV2LT4_1	96.8bp	31.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	Skipped	N/A%	78966	0.14%	0.69%	24798	0.02%	0.03%	0.53%	0.97%	420	212	13169	6266	0.00	0.00	0.00%	0.00%	0.92	0.000	9999000000	52902				31bp	30bp	79.9%	0.3%	9.2%	1.2%	7.3%	0.0M	38.4%	89.2%	3.7Mb	0.1M	69.6%	12.4%	55.0%
659_buj-T1-TRNA-1_B23MHV2LT4_1_1																																	96.8bp	5.3%	0.0M																94.6%	72%	151bp	151bp	45%	0.3M
659_buj-T1-TRNA-1_B23MHV2LT4_1_2																																																			87.4%	93%	151bp	151bp	55%	0.3M
659_buj-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			66.5%	67%	52bp	37bp	45%	0.0M	66.5%	67%	52bp	37bp	45%	0.0M
659_buj-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			67.6%	71%	54bp	37bp	45%	0.0M	67.6%	71%	54bp	37bp	45%	0.0M
659_c95-T1-TRNA-1_B23MHV2LT4_1	141.7bp	129.0bp	0.03%	1.06%	0.47%	0.00%	0.06%	3.23%	0.70%	0.00%	Yes	0.28%	591419316	0.01%	0.43%	334469192	0.94%	0.97%	0.05%	0.03%	314457959	158848041	16328799	5444629	609.93	305.00	0.75%	0.66%	0.97	0.000	9999000000	551228615				169bp	399bp	43.7%	0.0%	97.4%	88.6%	95.5%	282.4M	26.2%	97.1%	72684.9Mb	591.4M	53.9%	98.6%	57.5%
659_c95-T1-TRNA-1_B23MHV2LT4_1_1																																	141.7bp	97.9%	289.6M																85.0%	52%	151bp	151bp	27%	450.0M
659_c95-T1-TRNA-1_B23MHV2LT4_1_2																																																			84.3%	53%	151bp	151bp	18%	450.0M
659_c95-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			82.5%	53%	127bp	137bp	27%	295.7M	82.5%	53%	127bp	137bp	27%	295.7M
659_c95-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			82.7%	54%	127bp	137bp	18%	295.7M	82.7%	54%	127bp	137bp	18%	295.7M
659_cAa-T1-TRNA-1_B23MHV2LT4_1	109.9bp	91.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	Skipped	N/A%	41874	0.29%	0.50%	20838	0.02%	0.06%	0.39%	0.94%	515	258	8123	3858	0.00	0.00	0.00%	0.00%	0.94	0.000	9999000000	26431				30bp	31bp	70.9%	0.7%	25.4%	2.5%	12.7%	0.0M	78.5%	92.0%	2.6Mb	0.0M	69.9%	6.3%	52.0%
659_cAa-T1-TRNA-1_B23MHV2LT4_1_1																																	109.9bp	9.6%	0.0M																96.4%	73%	151bp	151bp	55%	0.3M
659_cAa-T1-TRNA-1_B23MHV2LT4_1_2																																																			92.1%	96%	151bp	151bp	55%	0.3M
659_cAa-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			56.1%	66%	66bp	37bp	45%	0.0M	56.1%	66%	66bp	37bp	45%	0.0M
659_cAa-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			58.2%	73%	68bp	37bp	55%	0.0M	58.2%	73%	68bp	37bp	55%	0.0M
659_cAd-T1-TRNA-1_B23MHV2LT4_1	126.2bp	118.0bp	0.02%	1.21%	0.76%	0.00%	0.04%	3.65%	1.10%	0.00%	Yes	0.00%	584760110	0.01%	0.58%	248129618	0.93%	0.96%	0.05%	0.04%	230752663	116194401	13134930	5027991	395.31	166.00	0.71%	0.58%	0.97	0.000	9999000000	237685914				132bp	235bp	58.0%	0.0%	97.7%	88.2%	95.3%	278.6M	34.3%	97.2%	68710.5Mb	584.8M	55.0%	98.7%	71.1%
659_cAd-T1-TRNA-1_B23MHV2LT4_1_1																																	126.2bp	98.2%	287.1M																84.0%	54%	151bp	151bp	18%	296.2M
659_cAd-T1-TRNA-1_B23MHV2LT4_1_2																																																			83.1%	54%	151bp	151bp	18%	296.2M
659_cAd-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			84.1%	54%	121bp	122bp	9%	292.4M	84.1%	54%	121bp	122bp	9%	292.4M
659_cAd-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			84.1%	55%	121bp	122bp	9%	292.4M	84.1%	55%	121bp	122bp	9%	292.4M
659_cB6-T1-TRNA-1_B23MHV2LT4_1	159.1bp	144.0bp	0.01%	0.42%	0.20%	0.00%	0.02%	1.53%	0.37%	0.00%	No	0.00%	589016434	0.01%	0.89%	64580434	0.82%	0.90%	0.12%	0.10%	52985153	26801167	7724358	2995275	104.36	44.00	0.58%	0.30%	0.97	0.000	9999000000	62703850				190bp	379bp	89.6%	0.0%	96.6%	84.0%	94.3%	277.7M	65.7%	96.8%	76035.1Mb	589.0M	58.2%	98.2%	45.9%
659_cB6-T1-TRNA-1_B23MHV2LT4_1_1																																	159.1bp	97.4%	286.9M																92.5%	56%	151bp	151bp	36%	302.6M
659_cB6-T1-TRNA-1_B23MHV2LT4_1_2																																																			89.9%	58%	151bp	151bp	18%	302.6M
659_cB6-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			92.6%	57%	133bp	151bp	18%	294.5M	92.6%	57%	133bp	151bp	18%	294.5M
659_cB6-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			91.4%	58%	133bp	151bp	9%	294.5M	91.4%	58%	133bp	151bp	9%	294.5M
659_cGW-T1-TRNA-1_B23MHV2LT4_1	133.6bp	126.0bp	0.00%	1.62%	0.55%	0.00%	0.00%	5.15%	0.99%	0.00%	No	0.00%	188870482	0.01%	0.83%	31573576	0.86%	0.92%	0.09%	0.08%	27241088	13687927	2822496	1182131	45.71	12.00	0.33%	0.11%	0.97	0.000	9999000000	35753944				154bp	291bp	84.0%	0.0%	97.5%	83.7%	94.0%	88.8M	55.7%	96.8%	22923.1Mb	188.9M	60.3%	98.2%	65.3%
659_cGW-T1-TRNA-1_B23MHV2LT4_1_1																																	133.6bp	97.6%	92.1M																88.1%	58%	151bp	151bp	18%	96.2M
659_cGW-T1-TRNA-1_B23MHV2LT4_1_2																																																			86.7%	59%	151bp	151bp	18%	96.2M
659_cGW-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			88.2%	60%	125bp	132bp	9%	94.4M	88.2%	60%	125bp	132bp	9%	94.4M
659_cGW-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			87.9%	60%	125bp	132bp	9%	94.4M	87.9%	60%	125bp	132bp	9%	94.4M
659_cIX-T1-TRNA-1_B23MHV2LT4_1	141.0bp	130.0bp	0.01%	1.08%	0.61%	0.00%	0.02%	3.53%	0.91%	0.00%	No	0.00%	592586016	0.00%	0.49%	300731970	0.94%	0.97%	0.05%	0.03%	283840397	143393463	14106730	4763548	550.20	231.00	0.72%	0.62%	0.97	0.000	9999000000	378835108				168bp	403bp	49.5%	0.0%	97.7%	91.8%	96.6%	286.1M	30.6%	97.2%	73955.8Mb	592.6M	54.3%	98.8%	57.7%
659_cIX-T1-TRNA-1_B23MHV2LT4_1_1																																	141.0bp	98.3%	291.4M																86.9%	53%	151bp	151bp	18%	439.0M
659_cIX-T1-TRNA-1_B23MHV2LT4_1_2																																																			85.7%	54%	151bp	151bp	18%	439.0M
659_cIX-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			84.5%	54%	128bp	137bp	9%	296.3M	84.5%	54%	128bp	137bp	9%	296.3M
659_cIX-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			84.3%	54%	128bp	137bp	9%	296.3M	84.3%	54%	128bp	137bp	9%	296.3M
659_cRB-T1-TRNA-1_B23MHV2LT4_1	120.5bp	114.0bp	0.02%	1.12%	0.65%	0.00%	0.04%	3.62%	0.97%	0.00%	No	0.00%	374062200	0.01%	0.65%	132336934	0.93%	0.95%	0.06%	0.05%	122550328	61627605	7551277	3045126	198.20	86.00	0.66%	0.47%	0.97	0.000	9999000000	116209919				133bp	255bp	65.0%	0.0%	97.8%	89.6%	95.9%	179.3M	38.4%	97.3%	43173.3Mb	374.1M	54.7%	98.8%	75.4%
659_cRB-T1-TRNA-1_B23MHV2LT4_1_1																																	120.5bp	98.4%	184.0M																83.3%	53%	151bp	151bp	18%	189.3M
659_cRB-T1-TRNA-1_B23MHV2LT4_1_2																																																			81.9%	54%	151bp	151bp	27%	189.3M
659_cRB-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			83.4%	54%	119bp	122bp	9%	187.0M	83.4%	54%	119bp	122bp	9%	187.0M
659_cRB-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			82.8%	54%	119bp	122bp	9%	187.0M	82.8%	54%	119bp	122bp	9%	187.0M
659_cRa-T1-TRNA-1_B23MHV2LT4_1	134.0bp	122.0bp	0.01%	0.88%	0.54%	0.00%	0.03%	3.05%	0.87%	0.00%	No	0.00%	590692572	0.01%	0.50%	292873212	0.94%	0.97%	0.05%	0.03%	275334178	138813135	13911383	4797310	522.95	258.00	0.75%	0.65%	0.97	0.000	9999000000	431801876				183bp	418bp	50.7%	0.0%	98.0%	90.6%	96.0%	283.6M	29.8%	97.0%	71064.8Mb	590.7M	55.6%	98.4%	61.4%
659_cRa-T1-TRNA-1_B23MHV2LT4_1_1																																	134.0bp	98.3%	290.4M																88.0%	54%	151bp	151bp	27%	535.5M
659_cRa-T1-TRNA-1_B23MHV2LT4_1_2																																																			86.9%	55%	151bp	151bp	18%	535.5M
659_cRa-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			84.6%	55%	124bp	132bp	36%	295.3M	84.6%	55%	124bp	132bp	36%	295.3M
659_cRa-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			84.7%	55%	124bp	132bp	27%	295.3M	84.7%	55%	124bp	132bp	27%	295.3M
659_cTi-T1-TRNA-1_B23MHV2LT4_1	133.1bp	121.0bp	0.02%	0.96%	0.52%	0.00%	0.04%	2.90%	0.79%	0.00%	No	0.00%	590653212	0.01%	0.45%	326348503	0.94%	0.97%	0.04%	0.03%	307963946	155230017	14612263	4960487	570.50	302.00	0.79%	0.68%	0.97	0.000	9999000000	491592590				151bp	352bp	45.0%	0.0%	97.9%	89.3%	95.5%	281.9M	24.8%	96.8%	70151.1Mb	590.7M	54.3%	98.4%	63.5%
659_cTi-T1-TRNA-1_B23MHV2LT4_1_1																																	133.1bp	98.2%	290.0M																85.4%	53%	151bp	151bp	27%	475.6M
659_cTi-T1-TRNA-1_B23MHV2LT4_1_2																																																			84.9%	54%	151bp	151bp	18%	475.6M
659_cTi-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			82.4%	54%	123bp	127bp	27%	295.3M	82.4%	54%	123bp	127bp	27%	295.3M
659_cTi-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			83.1%	54%	123bp	132bp	18%	295.3M	83.1%	54%	123bp	132bp	18%	295.3M
659_cVw-T1-TRNA-1_B23MHV2LT4_1	160.4bp	147.0bp	0.01%	1.29%	0.54%	0.00%	0.03%	4.10%	0.84%	0.00%	No	0.00%	592501942	0.01%	0.43%	339842659	0.94%	0.97%	0.05%	0.03%	320217336	162238355	15702728	4774917	683.28	324.00	0.76%	0.66%	0.97	0.000	9999000000	486055997				208bp	509bp	42.9%	0.0%	97.6%	88.4%	95.2%	282.0M	30.4%	97.2%	77970.9Mb	592.5M	55.3%	98.8%	44.9%
659_cVw-T1-TRNA-1_B23MHV2LT4_1_1																																	160.4bp	98.1%	290.7M																87.9%	54%	151bp	151bp	18%	495.8M
659_cVw-T1-TRNA-1_B23MHV2LT4_1_2																																																			86.9%	55%	151bp	151bp	18%	495.8M
659_cVw-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			85.0%	54%	135bp	151bp	9%	296.3M	85.0%	54%	135bp	151bp	9%	296.3M
659_cVw-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			84.8%	55%	135bp	151bp	9%	296.3M	84.8%	55%	135bp	151bp	9%	296.3M
659_cWx-T1-TRNA-1_B23MHV2LT4_1	146.0bp	135.0bp	0.01%	1.33%	0.53%	0.00%	0.03%	4.06%	0.85%	0.00%	No	0.00%	591450106	0.01%	0.52%	282988197	0.93%	0.96%	0.05%	0.04%	264035201	133566602	15162882	5192976	511.57	200.00	0.73%	0.61%	0.97	0.000	9999000000	302032516				172bp	331bp	52.5%	0.0%	96.9%	87.4%	95.0%	281.1M	34.9%	97.0%	74893.0Mb	591.5M	59.2%	98.6%	54.7%
659_cWx-T1-TRNA-1_B23MHV2LT4_1_1																																	146.0bp	97.6%	288.6M																86.4%	58%	151bp	151bp	18%	363.3M
659_cWx-T1-TRNA-1_B23MHV2LT4_1_2																																																			85.3%	58%	151bp	151bp	18%	363.3M
659_cWx-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			85.1%	58%	130bp	142bp	9%	295.7M	85.1%	58%	130bp	142bp	9%	295.7M
659_cWx-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			85.2%	59%	131bp	142bp	9%	295.7M	85.2%	59%	131bp	142bp	9%	295.7M
659_cYf-T1-TRNA-1_B23MHV2LT4_1	124.3bp	116.0bp	0.00%	1.72%	0.49%	0.00%	0.01%	5.24%	0.80%	0.00%	No	0.00%	589130454	0.01%	0.56%	260210466	0.93%	0.95%	0.06%	0.05%	241317738	121220474	15462371	6104248	412.26	124.00	0.68%	0.53%	0.97	0.000	9999000000	270559264				130bp	211bp	56.2%	0.0%	97.3%	87.3%	94.9%	279.5M	30.6%	96.7%	68038.9Mb	589.1M	59.7%	98.2%	70.7%
659_cYf-T1-TRNA-1_B23MHV2LT4_1_1																																	124.3bp	98.1%	288.9M																86.3%	57%	151bp	151bp	27%	436.9M
659_cYf-T1-TRNA-1_B23MHV2LT4_1_2																																																			85.2%	58%	151bp	151bp	27%	436.9M
659_cYf-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			83.7%	59%	119bp	122bp	27%	294.6M	83.7%	59%	119bp	122bp	27%	294.6M
659_cYf-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			84.0%	59%	120bp	122bp	18%	294.6M	84.0%	59%	120bp	122bp	18%	294.6M
659_cfy-T1-TRNA-1_B23MHV2LT4_1	137.1bp	125.0bp	0.04%	1.02%	0.67%	0.00%	0.09%	2.98%	0.94%	0.00%	No	0.00%	590638862	0.00%	0.45%	326582048	0.95%	0.97%	0.05%	0.03%	309113207	155910553	14722451	4862809	587.40	263.00	0.73%	0.63%	0.97	0.000	9999000000	481884076				159bp	374bp	44.9%	0.0%	97.8%	90.7%	96.1%	283.8M	26.1%	96.9%	71594.5Mb	590.6M	55.1%	98.4%	60.8%
659_cfy-T1-TRNA-1_B23MHV2LT4_1_1																																	137.1bp	98.3%	290.4M																85.7%	54%	151bp	151bp	27%	448.4M
659_cfy-T1-TRNA-1_B23MHV2LT4_1_2																																																			84.9%	54%	151bp	151bp	18%	448.4M
659_cfy-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			83.2%	54%	125bp	132bp	27%	295.3M	83.2%	54%	125bp	132bp	27%	295.3M
659_cfy-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			83.6%	55%	125bp	132bp	18%	295.3M	83.6%	55%	125bp	132bp	18%	295.3M
659_ciJ-T1-TRNA-1_B23MHV2LT4_1	144.0bp	130.0bp	0.01%	0.91%	0.44%	0.00%	0.03%	2.74%	0.67%	0.00%	No	0.00%	590367902	0.01%	0.41%	349952011	0.94%	0.97%	0.05%	0.03%	328375997	166010986	17660535	5798044	639.22	324.00	0.79%	0.68%	0.97	0.000	9999000000	555512314				163bp	347bp	41.0%	0.0%	96.9%	89.0%	95.4%	281.7M	24.3%	96.9%	72939.8Mb	590.4M	56.3%	98.4%	56.1%
659_ciJ-T1-TRNA-1_B23MHV2LT4_1_1																																	144.0bp	97.7%	288.4M																83.5%	55%	151bp	151bp	27%	392.5M
659_ciJ-T1-TRNA-1_B23MHV2LT4_1_2																																																			82.7%	55%	151bp	151bp	18%	392.5M
659_ciJ-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			81.6%	56%	127bp	142bp	27%	295.2M	81.6%	56%	127bp	142bp	27%	295.2M
659_ciJ-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			82.0%	56%	128bp	142bp	18%	295.2M	82.0%	56%	128bp	142bp	18%	295.2M
659_ciZ-T1-TRNA-1_B23MHV2LT4_1	128.4bp	122.0bp	0.02%	1.94%	0.68%	0.00%	0.03%	5.54%	0.97%	0.00%	No	0.00%	563329290	0.01%	0.68%	182154846	0.92%	0.95%	0.06%	0.05%	167845409	84511066	10907281	4295640	278.26	116.00	0.68%	0.53%	0.97	0.000	9999000000	145087037				135bp	259bp	68.1%	0.0%	97.9%	88.1%	95.2%	268.1M	43.4%	97.2%	67114.7Mb	563.3M	53.3%	98.8%	71.1%
659_ciZ-T1-TRNA-1_B23MHV2LT4_1_1																																	128.4bp	98.3%	276.8M																85.7%	52%	151bp	151bp	18%	285.1M
659_ciZ-T1-TRNA-1_B23MHV2LT4_1_2																																																			84.3%	53%	151bp	151bp	27%	285.1M
659_ciZ-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			85.8%	53%	122bp	127bp	9%	281.7M	85.8%	53%	122bp	127bp	9%	281.7M
659_ciZ-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			85.3%	53%	123bp	127bp	9%	281.7M	85.3%	53%	123bp	127bp	9%	281.7M
659_cq5-T1-TRNA-1_B23MHV2LT4_1	74.8bp	32.0bp	0.00%	0.24%	0.00%	0.00%	0.00%	0.61%	0.00%	0.00%	Skipped	N/A%	68426	0.16%	0.65%	23863	0.02%	0.04%	0.53%	0.96%	491	231	12555	5979	0.00	0.00	0.00%	0.00%	0.93	0.000	9999000000	43717				32bp	29bp	77.4%	1.1%	10.1%	1.3%	8.3%	0.0M	48.0%	89.8%	3.1Mb	0.1M	70.5%	11.7%	54.8%
659_cq5-T1-TRNA-1_B23MHV2LT4_1_1																																	74.8bp	4.8%	0.0M																94.3%	74%	151bp	151bp	55%	0.3M
659_cq5-T1-TRNA-1_B23MHV2LT4_1_2																																																			90.6%	94%	151bp	151bp	55%	0.3M
659_cq5-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			61.6%	68%	49bp	37bp	45%	0.0M	61.6%	68%	49bp	37bp	45%	0.0M
659_cq5-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			64.5%	72%	51bp	37bp	45%	0.0M	64.5%	72%	51bp	37bp	45%	0.0M
659_cuO-T1-TRNA-1_B23MHV2LT4_1	60.3bp	31.0bp	0.00%	0.51%	0.00%	0.00%	0.00%	1.64%	0.00%	0.00%	Skipped	N/A%	44638	0.17%	0.62%	16749	0.02%	0.04%	0.52%	0.96%	314	155	8630	4096	0.00	0.00	0.00%	0.00%	0.90	0.000	9999000000	37318				32bp	31bp	75.7%	0.2%	12.9%	1.4%	8.6%	0.0M	54.0%	88.3%	2.3Mb	0.0M	68.5%	11.6%	54.4%
659_cuO-T1-TRNA-1_B23MHV2LT4_1_1																																	60.3bp	8.0%	0.0M																94.2%	74%	151bp	151bp	64%	0.2M
659_cuO-T1-TRNA-1_B23MHV2LT4_1_2																																																			90.5%	94%	151bp	151bp	55%	0.2M
659_cuO-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			62.1%	66%	58bp	37bp	45%	0.0M	62.1%	66%	58bp	37bp	45%	0.0M
659_cuO-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			63.6%	70%	60bp	37bp	45%	0.0M	63.6%	70%	60bp	37bp	45%	0.0M
659_cwv-T1-TRNA-1_B23MHV2LT4_1	137.8bp	124.0bp	0.04%	1.79%	0.71%	0.00%	0.08%	5.04%	1.03%	0.00%	No	0.00%	591618360	0.01%	0.43%	339729081	0.95%	0.97%	0.04%	0.03%	321728618	162321009	14872321	4835368	620.40	268.00	0.74%	0.63%	0.97	0.000	9999000000	625631690				161bp	384bp	42.8%	0.0%	98.0%	89.0%	95.7%	282.9M	23.7%	97.1%	71588.8Mb	591.6M	55.6%	98.6%	59.8%
659_cwv-T1-TRNA-1_B23MHV2LT4_1_1																																	137.8bp	98.2%	290.6M																86.3%	54%	151bp	151bp	27%	542.4M
659_cwv-T1-TRNA-1_B23MHV2LT4_1_2																																																			85.7%	55%	151bp	151bp	18%	542.4M
659_cwv-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			83.0%	55%	125bp	132bp	27%	295.8M	83.0%	55%	125bp	132bp	27%	295.8M
659_cwv-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			83.3%	55%	125bp	137bp	18%	295.8M	83.3%	55%	125bp	137bp	18%	295.8M
659_d01-T1-TRNA-1_B23MHV2LT4_1	127.0bp	117.0bp	0.01%	1.07%	0.43%	0.00%	0.02%	3.29%	0.66%	0.00%	Yes	0.00%	590369440	0.01%	0.47%	314739608	0.93%	0.96%	0.06%	0.04%	293504563	147756088	17565272	6670599	506.18	278.00	0.77%	0.66%	0.97	0.000	9999000000	390107868				127bp	205bp	47.0%	0.0%	96.5%	88.3%	95.4%	281.5M	24.6%	97.0%	68433.4Mb	590.4M	54.6%	98.4%	69.1%
659_d01-T1-TRNA-1_B23MHV2LT4_1_1																																	127.0bp	97.7%	288.5M																81.1%	53%	151bp	151bp	27%	341.4M
659_d01-T1-TRNA-1_B23MHV2LT4_1_2																																																			79.6%	54%	151bp	151bp	18%	341.4M
659_d01-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			80.0%	54%	119bp	122bp	18%	295.2M	80.0%	54%	119bp	122bp	18%	295.2M
659_d01-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			79.7%	54%	120bp	122bp	18%	295.2M	79.7%	54%	120bp	122bp	18%	295.2M
659_d0M-T1-TRNA-1_B23MHV2LT4_1	89.8bp	37.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	Skipped	N/A%	78386	0.21%	0.60%	31354	0.02%	0.04%	0.45%	0.96%	577	277	14048	6664	0.00	0.00	0.00%	0.00%	0.94	0.000	9999000000	54472				32bp	29bp	76.3%	0.9%	12.1%	1.6%	9.3%	0.0M	75.1%	91.5%	4.0Mb	0.1M	70.0%	9.9%	53.7%
659_d0M-T1-TRNA-1_B23MHV2LT4_1_1																																	89.8bp	5.3%	0.0M																95.3%	73%	151bp	151bp	55%	0.4M
659_d0M-T1-TRNA-1_B23MHV2LT4_1_2																																																			91.1%	95%	151bp	151bp	55%	0.4M
659_d0M-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			62.0%	66%	55bp	37bp	45%	0.0M	62.0%	66%	55bp	37bp	45%	0.0M
659_d0M-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			63.7%	72%	57bp	37bp	45%	0.0M	63.7%	72%	57bp	37bp	45%	0.0M
659_d0V-T1-TRNA-1_B23MHV2LT4_1	72.7bp	31.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	Skipped	N/A%	89564	0.16%	0.65%	31265	0.02%	0.03%	0.52%	0.97%	590	272	16279	7747	0.00	0.00	0.00%	0.00%	0.94	0.000	9999000000	54314				31bp	29bp	77.6%	1.0%	9.3%	1.5%	9.2%	0.0M	54.7%	90.4%	4.0Mb	0.1M	70.6%	12.2%	55.0%
659_d0V-T1-TRNA-1_B23MHV2LT4_1_1																																	72.7bp	4.4%	0.0M																94.6%	72%	151bp	151bp	55%	0.4M
659_d0V-T1-TRNA-1_B23MHV2LT4_1_2																																																			91.4%	95%	151bp	151bp	55%	0.4M
659_d0V-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			64.3%	67%	48bp	37bp	45%	0.0M	64.3%	67%	48bp	37bp	45%	0.0M
659_d0V-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			66.0%	73%	51bp	37bp	45%	0.0M	66.0%	73%	51bp	37bp	45%	0.0M
659_dES-T1-TRNA-1_B23MHV2LT4_1	128.3bp	119.0bp	0.03%	1.35%	0.41%	0.00%	0.06%	4.00%	0.66%	0.00%	Yes	0.01%	591367314	0.01%	0.44%	332161845	0.93%	0.96%	0.05%	0.04%	310245244	156162695	17809072	6750750	550.80	277.00	0.76%	0.65%	0.97	0.000	9999000000	499627174				131bp	244bp	44.1%	0.0%	97.4%	87.4%	95.0%	280.7M	23.7%	96.9%	68999.6Mb	591.4M	53.1%	98.6%	68.4%
659_dES-T1-TRNA-1_B23MHV2LT4_1_1																																	128.3bp	98.1%	290.0M																81.7%	52%	151bp	151bp	27%	313.0M
659_dES-T1-TRNA-1_B23MHV2LT4_1_2																																																			81.3%	52%	151bp	151bp	18%	313.0M
659_dES-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			81.5%	52%	120bp	122bp	18%	295.7M	81.5%	52%	120bp	122bp	18%	295.7M
659_dES-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			82.1%	53%	120bp	127bp	9%	295.7M	82.1%	53%	120bp	127bp	9%	295.7M
659_dHy-T1-TRNA-1_B23MHV2LT4_1	151.2bp	140.0bp	0.01%	0.92%	0.43%	0.00%	0.02%	3.00%	0.71%	0.00%	Yes	0.01%	592499374	0.01%	0.43%	336711619	0.94%	0.97%	0.05%	0.03%	316119025	160027386	16562295	5423618	642.70	342.00	0.77%	0.68%	0.97	0.000	9999000000	486551439				189bp	453bp	43.5%	0.0%	97.3%	89.7%	95.8%	283.9M	29.6%	97.2%	76521.3Mb	592.5M	54.3%	98.7%	50.4%
659_dHy-T1-TRNA-1_B23MHV2LT4_1_1																																	151.2bp	97.9%	289.9M																83.7%	53%	151bp	151bp	18%	349.6M
659_dHy-T1-TRNA-1_B23MHV2LT4_1_2																																																			83.0%	54%	151bp	151bp	18%	349.6M
659_dHy-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			82.7%	54%	133bp	147bp	9%	296.2M	82.7%	54%	133bp	147bp	9%	296.2M
659_dHy-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			82.8%	54%	133bp	151bp	9%	296.2M	82.8%	54%	133bp	151bp	9%	296.2M
659_dKM-T1-TRNA-1_B23MHV2LT4_1	135.1bp	125.0bp	0.03%	2.34%	0.70%	0.00%	0.05%	6.20%	0.97%	0.00%	No	0.00%	592125358	0.00%	0.52%	286774455	0.94%	0.97%	0.05%	0.03%	269760351	136307428	14220977	4890056	497.80	214.00	0.70%	0.60%	0.97	0.000	9999000000	317950204				161bp	407bp	51.8%	0.0%	97.6%	89.7%	95.8%	283.8M	32.4%	97.3%	72572.5Mb	592.1M	53.2%	98.7%	62.6%
659_dKM-T1-TRNA-1_B23MHV2LT4_1_1																																	135.1bp	98.3%	290.9M																84.8%	53%	151bp	151bp	27%	328.0M
659_dKM-T1-TRNA-1_B23MHV2LT4_1_2																																																			83.7%	53%	151bp	151bp	18%	328.0M
659_dKM-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			84.3%	52%	126bp	132bp	18%	296.1M	84.3%	52%	126bp	132bp	18%	296.1M
659_dKM-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			84.1%	53%	126bp	132bp	9%	296.1M	84.1%	53%	126bp	132bp	9%	296.1M
659_dQk-T1-TRNA-1_B23MHV2LT4_1	89.4bp	91.0bp	0.00%	0.22%	0.00%	0.00%	0.00%	0.68%	0.00%	0.00%	Skipped	N/A%	73070	0.40%	0.43%	41653	0.01%	0.03%	0.29%	0.97%	333	164	12082	5782	0.00	0.00	0.00%	0.00%	0.94	0.000	9999000000	49210				31bp	32bp	71.7%	0.3%	8.8%	1.2%	5.5%	0.0M	45.7%	92.2%	5.1Mb	0.1M	63.5%	10.3%	53.4%
659_dQk-T1-TRNA-1_B23MHV2LT4_1_1																																	89.4bp	3.8%	0.0M																95.4%	72%	151bp	151bp	64%	0.4M
659_dQk-T1-TRNA-1_B23MHV2LT4_1_2																																																			92.2%	94%	151bp	151bp	55%	0.4M
659_dQk-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			64.3%	61%	74bp	47bp	45%	0.0M	64.3%	61%	74bp	47bp	45%	0.0M
659_dQk-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			65.6%	65%	76bp	57bp	45%	0.0M	65.6%	65%	76bp	57bp	45%	0.0M
659_dRe-T1-TRNA-1_B23MHV2LT4_1	147.3bp	136.0bp	0.02%	1.85%	0.45%	0.00%	0.04%	5.79%	0.74%	0.00%	No	0.00%	543605460	0.01%	0.47%	286383252	0.94%	0.97%	0.05%	0.03%	269648872	136452273	13768685	4487084	543.37	234.00	0.75%	0.63%	0.97	0.000	9999000000	430660614				182bp	436bp	47.6%	0.0%	97.7%	88.9%	95.3%	259.2M	30.8%	97.2%	68869.2Mb	543.6M	54.7%	98.8%	54.2%
659_dRe-T1-TRNA-1_B23MHV2LT4_1_1																																	147.3bp	98.3%	267.1M																84.3%	53%	151bp	151bp	18%	275.1M
659_dRe-T1-TRNA-1_B23MHV2LT4_1_2																																																			83.3%	54%	151bp	151bp	18%	275.1M
659_dRe-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			84.4%	54%	130bp	142bp	18%	271.8M	84.4%	54%	130bp	142bp	18%	271.8M
659_dRe-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			84.3%	54%	130bp	142bp	18%	271.8M	84.3%	54%	130bp	142bp	18%	271.8M
659_dXa-T1-TRNA-1_B23MHV2LT4_1	131.7bp	120.0bp	0.00%	0.82%	0.33%	0.00%	0.01%	2.63%	0.55%	0.00%	No	0.00%	588966436	0.01%	0.85%	90470685	0.86%	0.91%	0.10%	0.09%	77702099	39106676	9152130	3730746	129.55	40.00	0.55%	0.32%	0.97	0.000	9990000000	79823529				138bp	238bp	85.2%	0.0%	97.2%	86.8%	95.0%	279.9M	53.0%	96.7%	69110.0Mb	589.0M	60.4%	98.2%	65.0%
659_dXa-T1-TRNA-1_B23MHV2LT4_1_1																																	131.7bp	98.0%	288.6M																92.1%	58%	151bp	151bp	27%	360.3M
659_dXa-T1-TRNA-1_B23MHV2LT4_1_2																																																			89.7%	59%	151bp	151bp	18%	360.3M
659_dXa-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			91.4%	60%	121bp	127bp	18%	294.5M	91.4%	60%	121bp	127bp	18%	294.5M
659_dXa-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			90.4%	60%	121bp	127bp	18%	294.5M	90.4%	60%	121bp	127bp	18%	294.5M
659_dc8-T1-TRNA-1_B23MHV2LT4_1	144.7bp	132.0bp	0.03%	1.78%	0.54%	0.00%	0.06%	5.24%	0.81%	0.00%	No	0.00%	591909118	0.01%	0.50%	296405769	0.94%	0.96%	0.05%	0.04%	277840251	140566677	15238772	5128283	540.79	278.00	0.76%	0.65%	0.97	0.000	9999000000	327641262				175bp	401bp	50.2%	0.0%	97.1%	89.3%	95.6%	282.9M	33.8%	97.2%	74731.5Mb	591.9M	54.8%	98.7%	55.1%
659_dc8-T1-TRNA-1_B23MHV2LT4_1_1																																	144.7bp	97.8%	289.5M																88.0%	53%	151bp	151bp	18%	473.8M
659_dc8-T1-TRNA-1_B23MHV2LT4_1_2																																																			86.6%	54%	151bp	151bp	18%	473.8M
659_dc8-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			85.1%	54%	130bp	142bp	9%	296.0M	85.1%	54%	130bp	142bp	9%	296.0M
659_dc8-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			84.6%	55%	130bp	142bp	9%	296.0M	84.6%	55%	130bp	142bp	9%	296.0M
659_dcz-T1-TRNA-1_B23MHV2LT4_1	110.2bp	107.0bp	0.01%	1.22%	0.29%	0.00%	0.03%	3.64%	0.48%	0.00%	No	0.00%	320533036	0.01%	0.82%	57894998	0.82%	0.87%	0.13%	0.13%	47333232	23720151	7604199	3514690	64.15	25.00	0.47%	0.18%	0.97	0.000	9990000000	62328343				108bp	134bp	82.7%	0.0%	96.4%	84.3%	94.0%	150.7M	45.0%	97.3%	34322.9Mb	320.5M	55.1%	98.6%	85.4%
659_dcz-T1-TRNA-1_B23MHV2LT4_1_1																																	110.2bp	97.1%	155.7M																85.7%	54%	151bp	151bp	18%	162.6M
659_dcz-T1-TRNA-1_B23MHV2LT4_1_2																																																			84.6%	54%	151bp	151bp	27%	162.6M
659_dcz-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			85.7%	54%	110bp	107bp	9%	160.3M	85.7%	54%	110bp	107bp	9%	160.3M
659_dcz-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			85.6%	55%	110bp	112bp	9%	160.3M	85.6%	55%	110bp	112bp	9%	160.3M
659_dfA-T1-TRNA-1_B23MHV2LT4_1	152.3bp	137.0bp	0.03%	1.09%	0.39%	0.00%	0.07%	3.27%	0.61%	0.00%	No	0.00%	592143200	0.01%	0.37%	370160633	0.95%	0.97%	0.05%	0.03%	349866469	176877213	17203303	5365417	722.76	354.00	0.78%	0.68%	0.97	0.000	9999000000	709559715				199bp	550bp	37.7%	0.0%	97.9%	90.1%	95.9%	283.8M	23.1%	97.2%	74966.3Mb	592.1M	53.6%	98.7%	50.1%
659_dfA-T1-TRNA-1_B23MHV2LT4_1_1																																	152.3bp	98.2%	290.9M																85.7%	52%	151bp	151bp	27%	508.1M
659_dfA-T1-TRNA-1_B23MHV2LT4_1_2																																																			85.8%	53%	151bp	151bp	18%	508.1M
659_dfA-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			82.6%	53%	130bp	151bp	27%	296.1M	82.6%	53%	130bp	151bp	27%	296.1M
659_dfA-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			83.6%	53%	130bp	151bp	18%	296.1M	83.6%	53%	130bp	151bp	18%	296.1M
659_djb-T1-TRNA-1_B23MHV2LT4_1	127.3bp	119.0bp	0.03%	1.89%	0.61%	0.00%	0.06%	5.52%	0.91%	0.00%	No	0.00%	593390730	0.01%	0.59%	242018637	0.93%	0.96%	0.06%	0.04%	224878782	113296769	13550814	5244082	389.80	166.00	0.70%	0.58%	0.97	0.000	9990000000	225972577				139bp	288bp	59.6%	0.0%	97.7%	89.5%	95.8%	284.3M	35.4%	97.4%	70423.5Mb	593.4M	53.2%	98.9%	70.1%
659_djb-T1-TRNA-1_B23MHV2LT4_1_1																																	127.3bp	98.3%	291.6M																85.1%	52%	151bp	151bp	27%	321.1M
659_djb-T1-TRNA-1_B23MHV2LT4_1_2																																																			84.2%	53%	151bp	151bp	27%	321.1M
659_djb-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			84.7%	53%	122bp	127bp	18%	296.7M	84.7%	53%	122bp	127bp	18%	296.7M
659_djb-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			84.5%	53%	122bp	127bp	9%	296.7M	84.5%	53%	122bp	127bp	9%	296.7M
659_dkd-T1-TRNA-1_B23MHV2LT4_1	96.1bp	88.0bp	0.00%	0.00%	0.15%	0.00%	0.00%	0.00%	0.39%	0.00%	Skipped	N/A%	56056	0.13%	0.68%	17726	0.02%	0.04%	0.58%	0.96%	432	218	10199	4853	0.00	0.00	0.00%	0.00%	0.95	0.000	9999000000	34773				32bp	29bp	78.3%	0.6%	9.9%	1.3%	8.3%	0.0M	42.5%	91.5%	2.4Mb	0.1M	72.1%	15.2%	56.5%
659_dkd-T1-TRNA-1_B23MHV2LT4_1_1																																	96.1bp	4.9%	0.0M																93.0%	75%	151bp	151bp	55%	0.2M
659_dkd-T1-TRNA-1_B23MHV2LT4_1_2																																																			90.8%	94%	151bp	151bp	55%	0.2M
659_dkd-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			62.8%	70%	45bp	37bp	45%	0.0M	62.8%	70%	45bp	37bp	45%	0.0M
659_dkd-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			63.8%	74%	48bp	37bp	45%	0.0M	63.8%	74%	48bp	37bp	45%	0.0M
659_dm4-T1-TRNA-1_B23MHV2LT4_1	116.3bp	111.0bp	0.02%	1.26%	0.30%	0.00%	0.04%	3.76%	0.48%	0.00%	No	0.00%	378162192	0.01%	0.77%	86003193	0.87%	0.91%	0.10%	0.09%	74651176	37468723	8565191	3839345	108.86	44.00	0.57%	0.31%	0.97	0.000	9990000000	87693939				114bp	147bp	77.8%	0.0%	96.5%	85.7%	94.5%	178.7M	45.3%	97.3%	42172.3Mb	378.2M	54.7%	98.8%	80.2%
659_dm4-T1-TRNA-1_B23MHV2LT4_1_1																																	116.3bp	97.5%	184.3M																85.2%	53%	151bp	151bp	18%	191.5M
659_dm4-T1-TRNA-1_B23MHV2LT4_1_2																																																			83.9%	54%	151bp	151bp	27%	191.5M
659_dm4-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			85.3%	54%	115bp	117bp	9%	189.1M	85.3%	54%	115bp	117bp	9%	189.1M
659_dm4-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			84.8%	54%	115bp	117bp	9%	189.1M	84.8%	54%	115bp	117bp	9%	189.1M
659_dts-T1-TRNA-1_B23MHV2LT4_1	123.0bp	114.0bp	0.01%	0.92%	0.47%	0.00%	0.02%	2.77%	0.72%	0.00%	No	0.00%	590550610	0.01%	0.47%	310810378	0.94%	0.96%	0.05%	0.04%	290891095	146324357	15591914	5800629	494.58	265.00	0.77%	0.66%	0.97	0.000	9999000000	395892902				124bp	218bp	47.7%	0.0%	97.5%	87.4%	94.9%	280.3M	24.9%	96.9%	67182.0Mb	590.6M	55.2%	98.4%	72.3%
659_dts-T1-TRNA-1_B23MHV2LT4_1_1																																	123.0bp	98.1%	289.7M																82.2%	54%	151bp	151bp	27%	351.3M
659_dts-T1-TRNA-1_B23MHV2LT4_1_2																																																			81.3%	55%	151bp	151bp	18%	351.3M
659_dts-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			81.0%	54%	117bp	117bp	18%	295.3M	81.0%	54%	117bp	117bp	18%	295.3M
659_dts-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			81.3%	55%	118bp	117bp	18%	295.3M	81.3%	55%	118bp	117bp	18%	295.3M
659_dwi-T1-TRNA-1_B23MHV2LT4_1	67.9bp	31.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	Skipped	N/A%	163198	0.16%	0.69%	50760	0.02%	0.04%	0.47%	0.96%	971	463	23867	11341	0.00	0.00	0.00%	0.00%	0.95	0.000	9999000000	77803				30bp	28bp	81.9%	0.7%	6.8%	1.3%	8.0%	0.0M	73.7%	92.5%	6.9Mb	0.2M	71.0%	15.0%	56.4%
659_dwi-T1-TRNA-1_B23MHV2LT4_1_1																																	67.9bp	2.7%	0.0M																94.2%	72%	151bp	151bp	55%	0.5M
659_dwi-T1-TRNA-1_B23MHV2LT4_1_2																																																			90.7%	94%	151bp	151bp	55%	0.5M
659_dwi-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			67.4%	68%	45bp	37bp	45%	0.1M	67.4%	68%	45bp	37bp	45%	0.1M
659_dwi-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			68.8%	73%	47bp	37bp	45%	0.1M	68.8%	73%	47bp	37bp	45%	0.1M
659_e0S-T1-TRNA-1_B23MHV2LT4_1	73.0bp	31.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	Skipped	N/A%	24444	0.33%	0.45%	13503	0.01%	0.04%	0.39%	0.96%	197	103	5252	2525	0.00	0.00	0.00%	0.00%	0.93	0.000	9999000000	20703				31bp	33bp	66.8%	0.3%	17.0%	2.2%	10.1%	0.0M	56.8%	89.4%	1.7Mb	0.0M	68.4%	5.2%	51.4%
659_e0S-T1-TRNA-1_B23MHV2LT4_1_1																																	73.0bp	9.7%	0.0M																96.7%	74%	151bp	151bp	55%	0.2M
659_e0S-T1-TRNA-1_B23MHV2LT4_1_2																																																			93.9%	97%	151bp	151bp	55%	0.2M
659_e0S-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			55.8%	65%	75bp	42bp	55%	0.0M	55.8%	65%	75bp	42bp	55%	0.0M
659_e0S-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			58.1%	71%	77bp	42bp	55%	0.0M	58.1%	71%	77bp	42bp	55%	0.0M
659_eGK-T1-TRNA-1_B23MHV2LT4_1	147.1bp	133.0bp	0.02%	1.62%	0.47%	0.00%	0.05%	4.98%	0.73%	0.00%	No	0.00%	591869786	0.00%	0.41%	352153340	0.94%	0.97%	0.05%	0.03%	331855331	167654216	17518401	5862403	664.87	341.00	0.76%	0.67%	0.97	0.000	9999000000	603967282				173bp	396bp	40.7%	0.0%	97.0%	90.3%	96.0%	284.0M	25.3%	97.1%	74262.5Mb	591.9M	53.6%	98.6%	53.1%
659_eGK-T1-TRNA-1_B23MHV2LT4_1_1																																	147.1bp	97.9%	289.9M																85.1%	53%	151bp	151bp	27%	421.6M
659_eGK-T1-TRNA-1_B23MHV2LT4_1_2																																																			84.2%	53%	151bp	151bp	18%	421.6M
659_eGK-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			82.9%	53%	129bp	147bp	27%	295.9M	82.9%	53%	129bp	147bp	27%	295.9M
659_eGK-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			82.9%	53%	129bp	147bp	18%	295.9M	82.9%	53%	129bp	147bp	18%	295.9M
659_eHw-T1-TRNA-1_B23MHV2LT4_1	143.5bp	133.0bp	0.00%	0.57%	0.71%	0.00%	0.01%	2.00%	1.15%	0.00%	No	0.00%	591320318	0.01%	0.60%	236582908	0.94%	0.97%	0.05%	0.03%	222503098	112267069	10988969	3755290	430.87	124.00	0.70%	0.54%	0.97	0.000	9999000000	235522139				184bp	381bp	60.3%	0.0%	98.0%	90.5%	96.2%	284.3M	43.6%	97.1%	75067.2Mb	591.3M	60.6%	98.6%	55.9%
659_eHw-T1-TRNA-1_B23MHV2LT4_1_1																																	143.5bp	98.5%	291.1M																92.1%	59%	151bp	151bp	18%	908.7M
659_eHw-T1-TRNA-1_B23MHV2LT4_1_2																																																			91.0%	59%	151bp	151bp	18%	908.7M
659_eHw-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			86.5%	60%	131bp	142bp	9%	295.7M	86.5%	60%	131bp	142bp	9%	295.7M
659_eHw-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			86.7%	60%	131bp	142bp	9%	295.7M	86.7%	60%	131bp	142bp	9%	295.7M
659_eKx-T1-TRNA-1_B23MHV2LT4_1	72.8bp	32.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	Skipped	N/A%	77326	0.21%	0.59%	31638	0.02%	0.04%	0.46%	0.96%	615	291	14670	6948	0.00	0.00	0.00%	0.00%	0.95	0.000	9999000000	43703				29bp	28bp	74.9%	0.9%	12.0%	1.7%	10.0%	0.0M	69.8%	91.1%	3.8Mb	0.1M	71.1%	9.7%	53.7%
659_eKx-T1-TRNA-1_B23MHV2LT4_1_1																																	72.8bp	5.1%	0.0M																95.0%	73%	151bp	151bp	64%	0.4M
659_eKx-T1-TRNA-1_B23MHV2LT4_1_2																																																			89.4%	95%	151bp	151bp	55%	0.4M
659_eKx-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			59.5%	67%	52bp	37bp	45%	0.0M	59.5%	67%	52bp	37bp	45%	0.0M
659_eKx-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			61.3%	74%	55bp	37bp	45%	0.0M	61.3%	74%	55bp	37bp	45%	0.0M
659_ePR-T1-TRNA-1_B23MHV2LT4_1	142.8bp	133.0bp	0.01%	1.00%	0.32%	0.00%	0.02%	3.26%	0.52%	0.00%	No	0.00%	591855640	0.01%	0.54%	274252017	0.94%	0.96%	0.05%	0.04%	257254864	129888787	13868388	4901547	489.95	218.00	0.73%	0.62%	0.97	0.000	9999000000	287841048				161bp	362bp	53.9%	0.0%	97.5%	90.5%	96.1%	284.4M	35.5%	97.3%	74355.1Mb	591.9M	55.1%	98.6%	57.7%
659_ePR-T1-TRNA-1_B23MHV2LT4_1_1																																	142.8bp	98.2%	290.7M																86.0%	54%	151bp	151bp	18%	442.8M
659_ePR-T1-TRNA-1_B23MHV2LT4_1_2																																																			84.9%	54%	151bp	151bp	18%	442.8M
659_ePR-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			83.2%	54%	129bp	142bp	9%	295.9M	83.2%	54%	129bp	142bp	9%	295.9M
659_ePR-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			83.1%	55%	129bp	142bp	9%	295.9M	83.1%	55%	129bp	142bp	9%	295.9M
659_eZ4-T1-TRNA-1_B23MHV2LT4_1	151.9bp	137.0bp	0.03%	1.31%	0.39%	0.00%	0.07%	3.84%	0.57%	0.00%	No	0.00%	553987468	0.01%	0.42%	322910099	0.94%	0.97%	0.05%	0.03%	304324474	153967637	15793382	4976065	620.18	281.00	0.74%	0.64%	0.97	0.000	9999000000	544740151				202bp	554bp	41.9%	0.0%	97.6%	88.5%	95.4%	264.1M	25.3%	96.9%	69636.4Mb	554.0M	52.9%	98.6%	51.3%
659_eZ4-T1-TRNA-1_B23MHV2LT4_1_1																																	151.9bp	98.2%	271.9M																82.1%	52%	151bp	151bp	27%	281.0M
659_eZ4-T1-TRNA-1_B23MHV2LT4_1_2																																																			81.9%	53%	151bp	151bp	18%	281.0M
659_eZ4-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			82.2%	52%	130bp	147bp	18%	277.0M	82.2%	52%	130bp	147bp	18%	277.0M
659_eZ4-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			83.0%	53%	130bp	147bp	9%	277.0M	83.0%	53%	130bp	147bp	9%	277.0M
659_ecd-T1-TRNA-1_B23MHV2LT4_1	139.0bp	125.0bp	0.03%	0.81%	0.36%	0.00%	0.06%	2.49%	0.54%	0.00%	No	0.00%	591149182	0.01%	0.43%	336906120	0.94%	0.97%	0.05%	0.03%	317023071	160113219	16677694	5590663	608.75	301.00	0.77%	0.66%	0.97	0.000	9999000000	542471892				155bp	361bp	43.2%	0.0%	97.5%	89.6%	95.8%	283.2M	24.8%	96.8%	71772.0Mb	591.1M	53.7%	98.5%	58.9%
659_ecd-T1-TRNA-1_B23MHV2LT4_1_1																																	139.0bp	98.2%	290.2M																85.5%	52%	151bp	151bp	27%	475.5M
659_ecd-T1-TRNA-1_B23MHV2LT4_1_2																																																			84.3%	53%	151bp	151bp	18%	475.5M
659_ecd-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			82.6%	53%	125bp	137bp	27%	295.6M	82.6%	53%	125bp	137bp	27%	295.6M
659_ecd-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			82.3%	54%	125bp	137bp	18%	295.6M	82.3%	54%	125bp	137bp	18%	295.6M
659_eeB-T1-TRNA-1_B23MHV2LT4_1	98.7bp	115.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	Skipped	N/A%	38332	0.19%	0.60%	15361	0.02%	0.03%	0.51%	0.97%	245	122	7773	3690	0.00	0.00	0.00%	0.00%	0.91	0.000	9999000000	31715				32bp	31bp	74.1%	0.3%	13.4%	1.4%	8.5%	0.0M	48.3%	88.0%	2.0Mb	0.0M	69.6%	9.3%	53.4%
659_eeB-T1-TRNA-1_B23MHV2LT4_1_1																																	98.7bp	7.3%	0.0M																95.1%	74%	151bp	151bp	55%	0.2M
659_eeB-T1-TRNA-1_B23MHV2LT4_1_2																																																			92.3%	96%	151bp	151bp	55%	0.2M
659_eeB-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			60.7%	67%	59bp	37bp	45%	0.0M	60.7%	67%	59bp	37bp	45%	0.0M
659_eeB-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			62.7%	71%	61bp	37bp	45%	0.0M	62.7%	71%	61bp	37bp	45%	0.0M
659_egp-T1-TRNA-1_B23MHV2LT4_1	78.6bp	31.0bp	0.00%	0.00%	0.74%	0.00%	0.00%	0.00%	1.94%	0.00%	Skipped	N/A%	23940	0.23%	0.55%	10829	0.02%	0.04%	0.46%	0.96%	191	93	5014	2397	0.00	0.00	0.00%	0.00%	0.94	0.000	9999000000	19117				30bp	30bp	71.6%	0.3%	10.2%	1.1%	6.5%	0.0M	53.4%	87.5%	1.3Mb	0.0M	73.5%	6.1%	52.0%
659_egp-T1-TRNA-1_B23MHV2LT4_1_1																																	78.6bp	4.5%	0.0M																96.2%	74%	151bp	151bp	45%	0.2M
659_egp-T1-TRNA-1_B23MHV2LT4_1_2																																																			94.3%	97%	151bp	151bp	55%	0.2M
659_egp-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			57.4%	69%	60bp	37bp	55%	0.0M	57.4%	69%	60bp	37bp	55%	0.0M
659_egp-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			60.4%	77%	62bp	37bp	55%	0.0M	60.4%	77%	62bp	37bp	55%	0.0M
659_end-T1-TRNA-1_B23MHV2LT4_1	149.6bp	136.0bp	0.01%	0.64%	0.68%	0.00%	0.02%	2.05%	0.96%	0.00%	No	0.00%	592817660	0.01%	0.45%	327669208	0.94%	0.97%	0.04%	0.03%	309616088	156623458	14240005	4414960	622.33	259.00	0.71%	0.62%	0.97	0.000	9999000000	506138463				186bp	517bp	45.0%	0.0%	98.0%	91.2%	96.1%	285.0M	29.9%	97.3%	75223.3Mb	592.8M	53.7%	98.8%	53.9%
659_end-T1-TRNA-1_B23MHV2LT4_1_1																																	149.6bp	98.2%	291.1M																87.2%	52%	151bp	151bp	18%	410.2M
659_end-T1-TRNA-1_B23MHV2LT4_1_2																																																			86.1%	54%	151bp	151bp	18%	410.2M
659_end-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			85.5%	53%	130bp	142bp	9%	296.4M	85.5%	53%	130bp	142bp	9%	296.4M
659_end-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			85.1%	54%	130bp	147bp	9%	296.4M	85.1%	54%	130bp	147bp	9%	296.4M
659_epG-T1-TRNA-1_B23MHV2LT4_1	140.3bp	131.0bp	0.02%	1.31%	0.34%	0.00%	0.04%	4.33%	0.61%	0.00%	No	0.00%	591846602	0.01%	0.46%	322229854	0.94%	0.96%	0.05%	0.04%	301568068	152144220	16592064	6073660	572.22	277.00	0.76%	0.66%	0.97	0.000	9999000000	428740431				148bp	284bp	45.9%	0.0%	97.5%	83.9%	93.7%	277.2M	29.4%	97.3%	73196.3Mb	591.8M	53.8%	98.6%	60.3%
659_epG-T1-TRNA-1_B23MHV2LT4_1_1																																	140.3bp	98.2%	290.5M																85.5%	53%	151bp	151bp	18%	405.5M
659_epG-T1-TRNA-1_B23MHV2LT4_1_2																																																			84.5%	53%	151bp	151bp	18%	405.5M
659_epG-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			83.5%	53%	127bp	137bp	9%	295.9M	83.5%	53%	127bp	137bp	9%	295.9M
659_epG-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			83.6%	54%	127bp	137bp	9%	295.9M	83.6%	54%	127bp	137bp	9%	295.9M
659_epP-T1-TRNA-1_B23MHV2LT4_1	156.0bp	147.0bp	0.01%	0.78%	0.39%	0.00%	0.01%	2.54%	0.62%	0.00%	No	0.00%	591580728	0.01%	0.52%	284030677	0.93%	0.97%	0.05%	0.03%	265008287	134306369	14932507	4836835	543.62	260.00	0.75%	0.64%	0.97	0.000	9999000000	291918507				192bp	390bp	52.3%	0.0%	96.7%	86.0%	94.3%	279.1M	37.4%	97.1%	78094.3Mb	591.6M	56.9%	98.6%	45.4%
659_epP-T1-TRNA-1_B23MHV2LT4_1_1																																	156.0bp	97.7%	289.1M																88.0%	56%	151bp	151bp	18%	514.9M
659_epP-T1-TRNA-1_B23MHV2LT4_1_2																																																			87.0%	56%	151bp	151bp	18%	514.9M
659_epP-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			84.3%	56%	136bp	151bp	9%	295.8M	84.3%	56%	136bp	151bp	9%	295.8M
659_epP-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			84.4%	57%	136bp	151bp	9%	295.8M	84.4%	57%	136bp	151bp	9%	295.8M
659_epZ-T1-TRNA-1_B23MHV2LT4_1	133.5bp	126.0bp	0.00%	0.74%	0.45%	0.00%	0.00%	2.40%	0.77%	0.00%	No	0.00%	589939440	0.01%	0.72%	164253966	0.90%	0.94%	0.07%	0.06%	147924395	74489147	11831264	4769571	259.01	47.00	0.57%	0.39%	0.97	0.000	9999000000	143031693				156bp	290bp	72.7%	0.0%	97.1%	86.5%	94.8%	279.5M	46.4%	96.8%	71743.9Mb	589.9M	62.8%	98.3%	64.9%
659_epZ-T1-TRNA-1_B23MHV2LT4_1_1																																	133.5bp	97.4%	287.2M																91.0%	60%	151bp	151bp	18%	529.8M
659_epZ-T1-TRNA-1_B23MHV2LT4_1_2																																																			89.6%	61%	151bp	151bp	18%	529.8M
659_epZ-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			88.1%	62%	126bp	132bp	9%	295.0M	88.1%	62%	126bp	132bp	9%	295.0M
659_epZ-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			87.9%	63%	126bp	132bp	9%	295.0M	87.9%	63%	126bp	132bp	9%	295.0M
659_eu1-T1-TRNA-1_B23MHV2LT4_1	103.8bp	97.0bp	0.08%	1.64%	0.50%	0.00%	0.15%	4.57%	0.72%	0.00%	No	0.00%	271201014	0.01%	0.51%	132702640	0.92%	0.94%	0.06%	0.06%	121660497	60997132	8360432	3558992	172.13	78.00	0.66%	0.45%	0.97	0.000	9990000000	145351382				97bp	130bp	51.6%	0.0%	97.5%	84.7%	94.1%	127.5M	24.4%	97.1%	27226.0Mb	271.2M	53.6%	98.6%	86.3%
659_eu1-T1-TRNA-1_B23MHV2LT4_1_1																																	103.8bp	97.9%	132.8M																77.8%	52%	151bp	151bp	27%	137.5M
659_eu1-T1-TRNA-1_B23MHV2LT4_1_2																																																			75.4%	53%	151bp	151bp	27%	137.5M
659_eu1-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			77.7%	53%	103bp	102bp	18%	135.6M	77.7%	53%	103bp	102bp	18%	135.6M
659_eu1-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			76.3%	53%	104bp	102bp	9%	135.6M	76.3%	53%	104bp	102bp	9%	135.6M
659_ezg-T1-TRNA-1_B23MHV2LT4_1	138.9bp	130.0bp	0.01%	1.70%	0.68%	0.00%	0.03%	5.11%	1.00%	0.00%	Yes	0.00%	592324348	0.01%	0.50%	297094434	0.94%	0.97%	0.05%	0.03%	279591559	141211005	14005777	4795858	530.11	254.00	0.74%	0.64%	0.97	0.000	9999000000	343480961				166bp	380bp	50.1%	0.0%	97.6%	89.2%	95.7%	283.3M	32.4%	97.3%	73926.0Mb	592.3M	54.7%	98.7%	59.6%
659_ezg-T1-TRNA-1_B23MHV2LT4_1_1																																	138.9bp	98.0%	290.4M																86.5%	53%	151bp	151bp	18%	419.1M
659_ezg-T1-TRNA-1_B23MHV2LT4_1_2																																																			85.3%	54%	151bp	151bp	18%	419.1M
659_ezg-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			84.3%	54%	128bp	137bp	9%	296.2M	84.3%	54%	128bp	137bp	9%	296.2M
659_ezg-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			84.1%	54%	128bp	137bp	9%	296.2M	84.1%	54%	128bp	137bp	9%	296.2M
659_gK-T1-TRNA-1_B23MHV2LT4_1	150.7bp	138.0bp	0.02%	1.55%	0.54%	0.00%	0.05%	4.76%	0.84%	0.00%	No	0.00%	590690094	0.01%	0.43%	333942199	0.94%	0.97%	0.05%	0.03%	314693471	159295944	15845659	5038407	638.82	277.00	0.73%	0.63%	0.97	0.000	9999000000	479693780				179bp	409bp	43.7%	0.0%	97.4%	86.6%	94.5%	279.0M	28.3%	97.2%	75791.7Mb	590.7M	54.6%	98.7%	51.4%
659_gK-T1-TRNA-1_B23MHV2LT4_1_1																																	150.7bp	98.1%	289.8M																82.7%	53%	151bp	151bp	18%	299.1M
659_gK-T1-TRNA-1_B23MHV2LT4_1_2																																																			82.2%	54%	151bp	151bp	18%	299.1M
659_gK-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			82.8%	54%	132bp	147bp	9%	295.3M	82.8%	54%	132bp	147bp	9%	295.3M
659_gK-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			83.1%	54%	132bp	147bp	9%	295.3M	83.1%	54%	132bp	147bp	9%	295.3M
659_mK-T1-TRNA-2_B23MHV2LT4_1	115.3bp	107.0bp	0.06%	1.06%	0.57%	0.00%	0.11%	3.09%	0.83%	0.00%	Yes	0.00%	558623208	0.01%	0.55%	251497885	0.92%	0.95%	0.06%	0.05%	231979755	116448178	14800891	6023634	362.89	170.00	0.72%	0.59%	0.97	0.000	9990000000	259293850				110bp	161bp	55.4%	0.0%	97.5%	85.9%	94.5%	263.8M	25.6%	96.9%	60540.5Mb	558.6M	54.2%	98.5%	79.7%
659_mK-T1-TRNA-2_B23MHV2LT4_1_1																																	115.3bp	98.0%	273.7M																79.9%	52%	151bp	151bp	27%	283.7M
659_mK-T1-TRNA-2_B23MHV2LT4_1_2																																																			78.5%	53%	151bp	151bp	18%	283.7M
659_mK-T1-TRNA-2_B23MHV2LT4_1_trimmed_1																																																			79.9%	54%	112bp	112bp	18%	279.3M	79.9%	54%	112bp	112bp	18%	279.3M
659_mK-T1-TRNA-2_B23MHV2LT4_1_trimmed_2																																																			79.6%	54%	112bp	112bp	9%	279.3M	79.6%	54%	112bp	112bp	9%	279.3M
659_rd-T1-TRNA-1_B23MHV2LT4_1	155.3bp	142.0bp	0.01%	1.27%	0.31%	0.00%	0.01%	4.26%	0.51%	0.00%	No	0.00%	418384894	0.00%	0.41%	248300114	0.94%	0.97%	0.05%	0.03%	234478840	118850138	11891403	3672312	487.42	205.00	0.74%	0.61%	0.97	0.000	9990000000	398006702				204bp	550bp	40.8%	0.0%	97.3%	92.0%	96.6%	202.0M	27.5%	97.3%	54351.8Mb	418.4M	53.2%	98.8%	48.3%
659_rd-T1-TRNA-1_B23MHV2LT4_1_1																																	155.3bp	98.1%	205.3M																82.1%	52%	151bp	151bp	27%	211.7M
659_rd-T1-TRNA-1_B23MHV2LT4_1_2																																																			80.8%	53%	151bp	151bp	18%	211.7M
659_rd-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			82.2%	52%	133bp	151bp	18%	209.2M	82.2%	52%	133bp	151bp	18%	209.2M
659_rd-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			81.7%	53%	134bp	151bp	9%	209.2M	81.7%	53%	134bp	151bp	9%	209.2M
659_ri-T1-TRNA-1_B23MHV2LT4_1	104.2bp	98.0bp	0.08%	1.03%	0.52%	0.00%	0.14%	2.80%	0.69%	0.00%	No	0.00%	330319114	0.01%	0.55%	147101336	0.92%	0.94%	0.07%	0.06%	134992460	67701843	9563838	4053512	191.33	78.00	0.64%	0.45%	0.97	0.000	9990000000	151954376				100bp	133bp	55.9%	0.0%	97.4%	86.6%	95.0%	156.8M	24.2%	97.1%	33539.0Mb	330.3M	53.9%	98.6%	86.4%
659_ri-T1-TRNA-1_B23MHV2LT4_1_1																																	104.2bp	98.0%	161.9M																81.1%	52%	151bp	151bp	27%	167.5M
659_ri-T1-TRNA-1_B23MHV2LT4_1_2																																																			78.5%	53%	151bp	151bp	27%	167.5M
659_ri-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			81.1%	53%	104bp	102bp	18%	165.2M	81.1%	53%	104bp	102bp	18%	165.2M
659_ri-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			79.5%	54%	105bp	102bp	9%	165.2M	79.5%	54%	105bp	102bp	9%	165.2M
659_wQ-T1-TRNA-1_B23MHV2LT4_1	143.9bp	131.0bp	0.01%	0.47%	0.36%	0.00%	0.03%	1.80%	0.66%	0.00%	Yes	1.42%	590260544	0.01%	0.68%	188494032	0.92%	0.96%	0.06%	0.04%	173488916	87610929	11598757	4108529	335.86	151.00	0.73%	0.58%	0.97	0.000	9999000000	160943286				202bp	434bp	68.5%	0.0%	97.3%	90.8%	96.2%	284.0M	46.8%	96.9%	73813.2Mb	590.3M	56.9%	98.4%	54.3%
659_wQ-T1-TRNA-1_B23MHV2LT4_1_1																																	143.9bp	98.1%	289.5M																88.2%	55%	151bp	151bp	36%	351.6M
659_wQ-T1-TRNA-1_B23MHV2LT4_1_2																																																			86.6%	56%	151bp	151bp	27%	351.6M
659_wQ-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			87.2%	56%	129bp	142bp	27%	295.1M	87.2%	56%	129bp	142bp	27%	295.1M
659_wQ-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			86.9%	57%	129bp	142bp	27%	295.1M	86.9%	57%	129bp	142bp	27%	295.1M
659_zO-T1-TRNA-1_B23MHV2LT4_1	140.9bp	130.0bp	0.01%	0.80%	0.31%	0.00%	0.02%	2.59%	0.49%	0.00%	Yes	0.00%	592789766	0.01%	0.52%	285532917	0.93%	0.96%	0.06%	0.04%	266262164	134463882	15744978	5741807	501.94	251.00	0.76%	0.65%	0.97	0.000	9999000000	305639521				148bp	283bp	52.1%	0.0%	97.3%	89.1%	95.6%	283.4M	32.9%	97.2%	73771.1Mb	592.8M	54.2%	98.8%	59.7%
659_zO-T1-TRNA-1_B23MHV2LT4_1_1																																	140.9bp	98.1%	290.8M																84.8%	53%	151bp	151bp	18%	356.5M
659_zO-T1-TRNA-1_B23MHV2LT4_1_2																																																			83.4%	54%	151bp	151bp	18%	356.5M
659_zO-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																			83.6%	53%	128bp	137bp	9%	296.4M	83.6%	53%	128bp	137bp	9%	296.4M
659_zO-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																			83.0%	54%	128bp	137bp	9%	296.4M	83.0%	54%	128bp	137bp	9%	296.4M
FFPE_HD789_02_RNA_0014_B23MHV2LT4_1	160.2bp	145.0bp	0.02%	1.73%	0.54%	0.00%	0.04%	5.02%	0.85%	0.00%	Yes	62.44%	590717084	0.01%	0.40%	353035759	0.94%	0.97%	0.05%	0.03%	332327275	168487428	17180459	4989373	700.65	316.00	0.73%	0.64%	0.97	0.000	9999000000	549601287				215bp	572bp	40.5%	0.0%	97.2%	88.9%	95.7%	282.6M	26.4%	97.0%	76077.9Mb	590.7M	54.4%	98.5%	45.7%
FFPE_HD789_02_RNA_0014_B23MHV2LT4_1_1																																	160.2bp	97.9%	289.3M																84.9%	53%	151bp	151bp	27%	392.8M
FFPE_HD789_02_RNA_0014_B23MHV2LT4_1_2																																																			83.7%	54%	151bp	151bp	18%	392.8M
FFPE_HD789_02_RNA_0014_B23MHV2LT4_1_trimmed_1																																																			83.2%	54%	133bp	151bp	27%	295.4M	83.2%	54%	133bp	151bp	27%	295.4M
FFPE_HD789_02_RNA_0014_B23MHV2LT4_1_trimmed_2																																																			83.2%	54%	133bp	151bp	18%	295.4M	83.2%	54%	133bp	151bp	18%	295.4M
FFPE_HD789_02_RNA_0015_B23MHV2LT4_1	178.1bp	162.0bp	0.01%	1.83%	0.58%	0.00%	0.02%	5.43%	0.90%	0.00%	Yes	61.47%	592126740	0.01%	0.40%	356896276	0.94%	0.97%	0.05%	0.03%	335870434	171035285	17656326	4650289	758.84	327.00	0.73%	0.64%	0.97	0.000	9999000000	540503216				286bp	807bp	40.0%	0.0%	97.1%	89.8%	96.0%	284.2M	29.2%	97.2%	80206.3Mb	592.1M	54.9%	98.7%	35.1%
FFPE_HD789_02_RNA_0015_B23MHV2LT4_1_1																																	178.1bp	97.8%	289.5M																88.7%	54%	151bp	151bp	18%	763.3M
FFPE_HD789_02_RNA_0015_B23MHV2LT4_1_2																																																			88.0%	55%	151bp	151bp	18%	763.3M
FFPE_HD789_02_RNA_0015_B23MHV2LT4_1_trimmed_1																																																			83.1%	54%	139bp	151bp	9%	296.1M	83.1%	54%	139bp	151bp	9%	296.1M
FFPE_HD789_02_RNA_0015_B23MHV2LT4_1_trimmed_2																																																			83.6%	55%	139bp	151bp	9%	296.1M	83.6%	55%	139bp	151bp	9%	296.1M
FFPE_V4_0001_RNA_0003_B23MHV2LT4_1	156.0bp	141.0bp	0.01%	1.61%	1.24%	0.00%	0.03%	4.35%	1.67%	0.00%	No	0.00%	590659338	0.01%	0.45%	321950135	0.94%	0.97%	0.05%	0.03%	302611988	153335339	15698275	4642861	626.51	155.00	0.60%	0.53%	0.97	0.000	9999000000	418247823				220bp	605bp	45.8%	0.0%	97.2%	89.5%	95.6%	282.5M	29.0%	97.0%	75624.8Mb	590.7M	53.9%	98.4%	48.0%
FFPE_V4_0001_RNA_0003_B23MHV2LT4_1_1																																	156.0bp	97.5%	287.8M																86.6%	52%	151bp	151bp	27%	506.5M
FFPE_V4_0001_RNA_0003_B23MHV2LT4_1_2																																																			86.0%	54%	151bp	151bp	18%	506.5M
FFPE_V4_0001_RNA_0003_B23MHV2LT4_1_trimmed_1																																																			83.3%	53%	132bp	151bp	27%	295.3M	83.3%	53%	132bp	151bp	27%	295.3M
FFPE_V4_0001_RNA_0003_B23MHV2LT4_1_trimmed_2																																																			84.1%	54%	132bp	151bp	18%	295.3M	84.1%	54%	132bp	151bp	18%	295.3M
FFPE_V4_0001_RNA_0003_B23MHV2LT4_2	156.4bp	144.0bp	0.01%	1.74%	1.34%	0.00%	0.02%	4.67%	1.74%	0.00%	No	0.00%	592086202	0.01%	0.52%	282074728	0.94%	0.97%	0.05%	0.03%	265175023	134404200	13385482	4012396	547.66	129.00	0.59%	0.52%	0.97	0.000	9999000000	295730522				221bp	607bp	52.7%	0.0%	97.5%	90.1%	95.9%	283.8M	35.5%	97.1%	77120.2Mb	592.1M	54.3%	98.7%	48.2%
FFPE_V4_0001_RNA_0003_B23MHV2LT4_2_1																																	156.4bp	97.6%	289.0M																89.3%	53%	151bp	151bp	18%	547.9M
FFPE_V4_0001_RNA_0003_B23MHV2LT4_2_2																																																			88.0%	54%	151bp	151bp	18%	547.9M
FFPE_V4_0001_RNA_0003_B23MHV2LT4_2_trimmed_1																																																			85.7%	53%	134bp	151bp	9%	296.0M	85.7%	53%	134bp	151bp	9%	296.0M
FFPE_V4_0001_RNA_0003_B23MHV2LT4_2_trimmed_2																																																			85.5%	54%	134bp	151bp	9%	296.0M	85.5%	54%	134bp	151bp	9%	296.0M
NTC_0001_0001_B23MHV2LT4_1	61.4bp	31.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	Skipped	N/A%	47120	0.44%	0.46%	25521	0.01%	0.06%	0.17%	0.94%	284	137	4435	2002	0.00	0.00	0.00%	0.00%	0.94	0.000	9999000000	27385				33bp	32bp	82.1%	0.8%	11.3%	0.9%	4.0%	0.0M	42.2%	88.4%	2.9Mb	0.0M	69.7%	13.1%	53.3%
NTC_0001_0001_B23MHV2LT4_1_1																																	61.4bp	4.8%	0.0M																93.6%	73%	151bp	151bp	55%	0.2M
NTC_0001_0001_B23MHV2LT4_1_2																																																			90.3%	94%	151bp	151bp	55%	0.2M
NTC_0001_0001_B23MHV2LT4_1_trimmed_1																																																			60.9%	68%	48bp	37bp	45%	0.0M	60.9%	68%	48bp	37bp	45%	0.0M
NTC_0001_0001_B23MHV2LT4_1_trimmed_2																																																			61.5%	70%	90bp	72bp	55%	0.0M	61.5%	70%	90bp	72bp	55%	0.0M
NTC_0001_0001_B23MHV2LT4_2	62.3bp	31.0bp	0.00%	0.52%	0.05%	0.00%	0.00%	1.17%	0.06%	0.00%	Skipped	N/A%	488868	0.95%	0.04%	467367	0.00%	0.05%	0.01%	0.95%	231	116	4728	2331	0.00	0.00	0.00%	0.00%	0.93	0.000	9999000000	20758				33bp	32bp	81.3%	0.3%	17.0%	0.5%	0.6%	0.0M	57.1%	69.6%	49.0Mb	0.5M	85.6%	93.7%	6.7%
NTC_0001_0001_B23MHV2LT4_2_1																																	62.3bp	0.8%	0.0M																94.3%	72%	151bp	151bp	64%	0.3M
NTC_0001_0001_B23MHV2LT4_2_2																																																			90.7%	96%	151bp	151bp	55%	0.3M
NTC_0001_0001_B23MHV2LT4_2_trimmed_1																																																			94.9%	72%	145bp	151bp	64%	0.2M	94.9%	72%	145bp	151bp	64%	0.2M
NTC_0001_0001_B23MHV2LT4_2_trimmed_2																																																			95.1%	98%	143bp	151bp	55%	0.2M	95.1%	98%	143bp	151bp	55%	0.2M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Custom content: SeqTools (general stats)	Reads	SeqTools (general stats) — reads	`reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Unmapped	SeqTools (general stats) — frac unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools (general stats)	Frac Dupes	SeqTools (general stats) — frac dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools (general stats)	Unique Reads	SeqTools (general stats) — unique reads	`unique_reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads On Target	SeqTools (general stats) — frac reads on target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs On Target	SeqTools (general stats) — frac pairs on target	`frac_pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads Off Target	SeqTools (general stats) — frac reads off target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs Off Target	SeqTools (general stats) — frac pairs off target	`frac_pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads On Target	SeqTools (general stats) — reads on target	`reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs On Target	SeqTools (general stats) — pairs on target	`pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads Off Target	SeqTools (general stats) — reads off target	`reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs Off Target	SeqTools (general stats) — pairs off target	`pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Mean Depth	SeqTools (general stats) — mean depth	`mean_depth`	None
\|\|	Custom content: SeqTools (general stats)	Q50 Depth	SeqTools (general stats) — q50 depth	`q50_depth`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt30X	SeqTools (general stats) — frac bases gt30x	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt100X	SeqTools (general stats) — frac bases gt100x	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools (general stats)	N Q30	SeqTools (general stats) — n q30	`n_q30`	None
\|\|	Custom content: SeqTools (general stats)	GC Bias	SeqTools (general stats) — Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: InsertSizeMetrics	Insert Size	Median Insert Size, all read orientations (bp)	`summed_median`	None
\|\|	Picard: InsertSizeMetrics	Mean Insert Size	Mean Insert Size, all read orientations (bp)	`summed_mean`	None
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	Picard: RnaSeqMetrics	rRNA	Percent of aligned bases overlapping ribosomal RNA regions	`PCT_RIBOSOMAL_BASES`	None
\|\|	Picard: RnaSeqMetrics	mRNA	Percent of aligned bases overlapping UTRs and coding regions of mRNA transcripts	`PCT_MRNA_BASES`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Insert Size

Plot shows the number of reads at a given insert size. Reads with different orientations are summed.

Created with MultiQC

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

RnaSeqMetrics Assignment

Number of bases in primary alignments that align to regions in the reference genome.

Created with MultiQC

Gene Coverage

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁹⁶/₉₆ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
659_1q-T1-TRNA-1_B23MHV2LT4_1	636.6M	0.0M	0.0M	43.3M	3.1M	571.2M	285.7M	285.5M	285.7M	285.6M	303.3M	267.9M	569.5M	0.0M
659_6i-T1-TRNA-1_B23MHV2LT4_1	465.5M	0.0M	0.0M	38.3M	2.9M	408.7M	204.5M	204.2M	204.4M	204.3M	245.2M	163.5M	407.3M	0.0M
659_8h-T1-TRNA-1_B23MHV2LT4_1	0.5M	0.0M	0.0M	0.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_Dd-T1-TRNA-1_B23MHV2LT4_1	629.4M	0.0M	0.0M	35.8M	3.7M	573.4M	286.8M	286.6M	286.8M	286.6M	268.2M	305.2M	571.3M	0.0M
659_Dl-T1-TRNA-1_B23MHV2LT4_1	454.3M	0.0M	0.0M	46.5M	3.3M	385.1M	192.8M	192.4M	192.6M	192.5M	231.2M	154.0M	383.8M	0.0M
659_Fr-T1-TRNA-1_B23MHV2LT4_1	644.6M	0.0M	0.0M	49.9M	3.3M	568.9M	284.6M	284.3M	284.5M	284.4M	301.0M	267.9M	567.1M	0.0M
659_Kh-T1-TRNA-1_B23MHV2LT4_1	7.2M	0.0M	0.0M	1.0M	0.0M	5.9M	3.0M	3.0M	3.0M	3.0M	2.9M	3.0M	5.9M	0.0M
659_Lx-T1-TRNA-1_B23MHV2LT4_1	582.4M	0.0M	0.0M	44.3M	2.7M	518.2M	259.2M	259.0M	259.2M	259.1M	296.9M	221.4M	516.4M	0.0M
659_Mt-T1-TRNA-1_B23MHV2LT4_1	653.3M	0.0M	0.0M	58.4M	3.8M	566.7M	283.5M	283.2M	283.4M	283.3M	320.8M	245.9M	565.0M	0.0M
659_On-T1-TRNA-2_B23MHV2LT4_1	634.9M	0.0M	0.0M	41.5M	2.8M	571.7M	286.0M	285.7M	285.9M	285.8M	308.9M	262.8M	569.7M	0.0M
659_R1-T1-TRNA-1_B23MHV2LT4_1	1.0M	0.0M	0.0M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_SP-T1-TRNA-1_B23MHV2LT4_1	636.9M	0.0M	0.0M	42.0M	3.8M	572.0M	286.1M	285.8M	286.0M	285.9M	305.2M	266.7M	570.2M	0.0M
659_Wm-T1-TRNA-1_B23MHV2LT4_1	0.4M	0.0M	0.0M	0.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_b4x-T1-TRNA-1_B23MHV2LT4_1	163.4M	0.0M	0.0M	19.2M	1.3M	136.6M	68.4M	68.2M	68.3M	68.3M	91.6M	45.0M	136.1M	0.0M
659_b6o-T1-TRNA-1_B23MHV2LT4_1	0.5M	0.0M	0.0M	0.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_b7Z-T1-TRNA-1_B23MHV2LT4_1	645.5M	0.0M	0.0M	50.6M	3.9M	566.8M	283.5M	283.3M	283.4M	283.4M	269.5M	297.3M	565.0M	0.0M
659_bCu-T1-TRNA-1_B23MHV2LT4_1	559.8M	0.0M	0.0M	47.1M	3.8M	490.6M	245.5M	245.1M	245.3M	245.3M	309.1M	181.6M	489.0M	0.0M
659_bGW-T1-TRNA-1_B23MHV2LT4_1	645.3M	0.0M	0.0M	51.9M	3.2M	566.5M	283.4M	283.1M	283.3M	283.2M	301.4M	265.1M	564.7M	0.0M
659_bGc-T1-TRNA-1_B23MHV2LT4_1	635.3M	0.0M	0.0M	42.8M	3.3M	570.8M	285.5M	285.3M	285.5M	285.4M	328.7M	242.2M	569.2M	0.0M
659_bIB-T1-TRNA-1_B23MHV2LT4_1	641.8M	0.0M	0.0M	46.7M	3.3M	569.6M	284.9M	284.7M	284.8M	284.7M	265.3M	304.3M	567.7M	0.0M
659_bKP-T1-TRNA-1_B23MHV2LT4_1	650.1M	0.0M	0.0M	55.5M	3.6M	565.6M	283.0M	282.7M	282.8M	282.8M	299.0M	266.6M	563.6M	0.0M
659_bMa-T1-TRNA-1_B23MHV2LT4_1	370.6M	0.0M	0.0M	46.0M	3.4M	304.6M	152.5M	152.1M	152.3M	152.3M	183.9M	120.7M	303.5M	0.0M
659_bNS-T1-TRNA-1_B23MHV2LT4_1	634.3M	0.0M	0.0M	41.1M	3.4M	570.2M	285.2M	285.0M	285.2M	285.1M	289.2M	281.1M	568.2M	0.0M
659_bQZ-T1-TRNA-1_B23MHV2LT4_1	641.3M	0.0M	0.0M	46.8M	5.5M	568.0M	284.2M	283.8M	284.1M	283.9M	288.7M	279.3M	565.9M	0.0M
659_bR4-T1-TRNA-1_B23MHV2LT4_1	632.9M	0.0M	0.0M	48.6M	3.7M	559.1M	279.7M	279.4M	279.6M	279.5M	312.6M	246.5M	556.9M	0.0M
659_bTo-T1-TRNA-1_B23MHV2LT4_1	622.0M	0.0M	0.0M	27.7M	2.5M	578.0M	289.1M	288.9M	289.1M	288.9M	273.3M	304.7M	576.3M	0.0M
659_bTq-T1-TRNA-1_B23MHV2LT4_1	640.1M	0.0M	0.0M	47.1M	3.8M	569.6M	284.9M	284.7M	284.8M	284.8M	293.3M	276.3M	568.0M	0.0M
659_bUW-T1-TRNA-1_B23MHV2LT4_1	679.3M	0.0M	0.0M	85.9M	3.8M	547.5M	273.9M	273.6M	273.8M	273.7M	271.7M	275.8M	545.6M	0.0M
659_bUs-T1-TRNA-1_B23MHV2LT4_1	626.9M	0.0M	0.0M	32.3M	2.7M	576.4M	288.3M	288.1M	288.3M	288.2M	262.5M	313.9M	574.3M	0.0M
659_bhK-T1-TRNA-1_B23MHV2LT4_1	627.0M	0.0M	0.0M	34.1M	3.5M	574.0M	287.2M	286.8M	287.1M	286.9M	280.4M	293.6M	571.9M	0.0M
659_bjQ-T1-TRNA-1_B23MHV2LT4_1	636.8M	0.0M	0.0M	43.6M	4.0M	570.4M	285.4M	285.0M	285.3M	285.1M	304.8M	265.6M	568.7M	0.0M
659_buD-T1-TRNA-1_B23MHV2LT4_1	638.1M	0.0M	0.0M	43.9M	3.9M	571.3M	285.8M	285.5M	285.7M	285.6M	297.5M	273.8M	569.0M	0.0M
659_bua-T1-TRNA-1_B23MHV2LT4_1	628.0M	0.0M	0.0M	33.7M	3.0M	575.7M	288.0M	287.7M	287.9M	287.8M	299.8M	275.9M	573.9M	0.0M
659_buj-T1-TRNA-1_B23MHV2LT4_1	0.6M	0.0M	0.0M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_c95-T1-TRNA-1_B23MHV2LT4_1	641.5M	0.0M	0.0M	47.7M	3.7M	570.4M	285.3M	285.0M	285.2M	285.1M	289.0M	281.3M	568.4M	0.0M
659_cAa-T1-TRNA-1_B23MHV2LT4_1	0.2M	0.0M	0.0M	0.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_cAd-T1-TRNA-1_B23MHV2LT4_1	635.8M	0.0M	0.0M	48.7M	4.2M	562.4M	281.3M	281.0M	281.2M	281.1M	309.3M	253.1M	560.5M	0.0M
659_cB6-T1-TRNA-1_B23MHV2LT4_1	664.7M	0.0M	0.0M	73.6M	3.9M	560.1M	280.2M	279.9M	280.1M	280.0M	304.3M	255.8M	558.3M	0.0M
659_cGW-T1-TRNA-1_B23MHV2LT4_1	213.9M	0.0M	0.0M	24.0M	1.5M	179.7M	89.9M	89.8M	89.9M	89.8M	93.0M	86.7M	179.0M	0.0M
659_cIX-T1-TRNA-1_B23MHV2LT4_1	626.8M	0.0M	0.0M	32.1M	2.8M	577.4M	288.8M	288.5M	288.7M	288.6M	292.3M	285.0M	575.5M	0.0M
659_cRB-T1-TRNA-1_B23MHV2LT4_1	402.9M	0.0M	0.0M	27.4M	2.2M	362.1M	181.2M	181.0M	181.1M	181.0M	190.0M	172.2M	360.9M	0.0M
659_cRa-T1-TRNA-1_B23MHV2LT4_1	630.1M	0.0M	0.0M	37.1M	3.6M	572.7M	286.6M	286.2M	286.5M	286.3M	272.9M	299.8M	570.7M	0.0M
659_cTi-T1-TRNA-1_B23MHV2LT4_1	635.8M	0.0M	0.0M	42.5M	3.8M	570.0M	285.2M	284.9M	285.1M	285.0M	292.6M	277.4M	567.8M	0.0M
659_cVw-T1-TRNA-1_B23MHV2LT4_1	641.4M	0.0M	0.0M	46.9M	3.9M	568.7M	284.5M	284.2M	284.4M	284.3M	282.1M	286.6M	567.0M	0.0M
659_cWx-T1-TRNA-1_B23MHV2LT4_1	647.0M	0.0M	0.0M	53.2M	3.8M	567.6M	284.0M	283.6M	283.8M	283.8M	302.4M	265.2M	565.7M	0.0M
659_cYf-T1-TRNA-1_B23MHV2LT4_1	645.4M	0.0M	0.0M	53.5M	3.4M	565.6M	283.1M	282.5M	282.9M	282.7M	331.0M	234.6M	563.2M	0.0M
659_cfy-T1-TRNA-1_B23MHV2LT4_1	629.6M	0.0M	0.0M	36.7M	2.7M	573.2M	286.7M	286.5M	286.6M	286.5M	291.6M	281.6M	571.2M	0.0M
659_ciJ-T1-TRNA-1_B23MHV2LT4_1	637.5M	0.0M	0.0M	44.5M	3.9M	569.4M	284.9M	284.6M	284.8M	284.7M	306.8M	262.6M	567.2M	0.0M
659_ciZ-T1-TRNA-1_B23MHV2LT4_1	612.7M	0.0M	0.0M	47.0M	3.4M	541.4M	270.8M	270.6M	270.7M	270.7M	285.9M	255.5M	539.5M	0.0M
659_cq5-T1-TRNA-1_B23MHV2LT4_1	0.5M	0.0M	0.0M	0.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_cuO-T1-TRNA-1_B23MHV2LT4_1	0.3M	0.0M	0.0M	0.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_cwv-T1-TRNA-1_B23MHV2LT4_1	639.1M	0.0M	0.0M	45.4M	3.1M	570.4M	285.3M	285.0M	285.2M	285.2M	290.5M	279.9M	568.7M	0.0M
659_d01-T1-TRNA-1_B23MHV2LT4_1	641.2M	0.0M	0.0M	48.7M	3.7M	568.0M	284.2M	283.8M	284.0M	283.9M	339.2M	228.8M	566.2M	0.0M
659_d0M-T1-TRNA-1_B23MHV2LT4_1	0.5M	0.0M	0.0M	0.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_d0V-T1-TRNA-1_B23MHV2LT4_1	0.6M	0.0M	0.0M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_dES-T1-TRNA-1_B23MHV2LT4_1	646.8M	0.0M	0.0M	53.0M	4.1M	567.2M	283.8M	283.4M	283.6M	283.5M	313.7M	253.5M	565.1M	0.0M
659_dHy-T1-TRNA-1_B23MHV2LT4_1	637.1M	0.0M	0.0M	42.3M	4.0M	573.1M	286.7M	286.4M	286.6M	286.5M	286.8M	286.3M	571.2M	0.0M
659_dKM-T1-TRNA-1_B23MHV2LT4_1	636.9M	0.0M	0.0M	42.2M	2.8M	573.7M	286.9M	286.7M	286.9M	286.8M	280.8M	292.8M	571.5M	0.0M
659_dQk-T1-TRNA-1_B23MHV2LT4_1	0.4M	0.0M	0.0M	0.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_dRe-T1-TRNA-1_B23MHV2LT4_1	585.7M	0.0M	0.0M	40.4M	3.0M	522.3M	261.3M	261.1M	261.2M	261.1M	258.1M	264.3M	520.9M	0.0M
659_dXa-T1-TRNA-1_B23MHV2LT4_1	648.6M	0.0M	0.0M	57.5M	3.6M	564.9M	282.6M	282.2M	282.5M	282.4M	329.5M	235.3M	563.0M	0.0M
659_dc8-T1-TRNA-1_B23MHV2LT4_1	636.9M	0.0M	0.0M	42.8M	3.3M	570.9M	285.6M	285.3M	285.5M	285.4M	289.7M	281.2M	569.0M	0.0M
659_dcz-T1-TRNA-1_B23MHV2LT4_1	360.2M	0.0M	0.0M	38.1M	3.0M	304.6M	152.5M	152.2M	152.3M	152.3M	201.3M	103.3M	303.5M	0.0M
659_dfA-T1-TRNA-1_B23MHV2LT4_1	634.0M	0.0M	0.0M	39.4M	3.1M	573.8M	287.0M	286.7M	286.9M	286.8M	283.0M	290.8M	571.5M	0.0M
659_djb-T1-TRNA-1_B23MHV2LT4_1	638.7M	0.0M	0.0M	43.3M	3.6M	573.2M	286.7M	286.5M	286.6M	286.5M	298.0M	275.1M	571.5M	0.0M
659_dkd-T1-TRNA-1_B23MHV2LT4_1	0.4M	0.0M	0.0M	0.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_dm4-T1-TRNA-1_B23MHV2LT4_1	419.8M	0.0M	0.0M	40.1M	2.8M	360.7M	180.5M	180.2M	180.4M	180.3M	231.9M	128.8M	359.6M	0.0M
659_dts-T1-TRNA-1_B23MHV2LT4_1	646.1M	0.0M	0.0M	52.9M	4.3M	566.6M	283.4M	283.2M	283.3M	283.2M	320.4M	246.1M	564.5M	0.0M
659_dwi-T1-TRNA-1_B23MHV2LT4_1	1.1M	0.0M	0.0M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_e0S-T1-TRNA-1_B23MHV2LT4_1	0.1M	0.0M	0.0M	0.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_eGK-T1-TRNA-1_B23MHV2LT4_1	632.6M	0.0M	0.0M	38.5M	2.8M	573.4M	286.8M	286.5M	286.7M	286.7M	300.3M	273.1M	571.4M	0.0M
659_eHw-T1-TRNA-1_B23MHV2LT4_1	633.0M	0.0M	0.0M	39.1M	3.1M	575.0M	287.7M	287.3M	287.6M	287.4M	284.4M	290.6M	572.8M	0.0M
659_eKx-T1-TRNA-1_B23MHV2LT4_1	0.5M	0.0M	0.0M	0.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_ePR-T1-TRNA-1_B23MHV2LT4_1	632.5M	0.0M	0.0M	38.4M	3.1M	574.2M	287.3M	287.0M	287.1M	287.1M	299.0M	275.2M	572.3M	0.0M
659_eZ4-T1-TRNA-1_B23MHV2LT4_1	599.8M	0.0M	0.0M	43.9M	2.8M	532.8M	266.5M	266.2M	266.4M	266.4M	263.1M	269.7M	531.1M	0.0M
659_ecd-T1-TRNA-1_B23MHV2LT4_1	635.8M	0.0M	0.0M	42.6M	3.2M	571.1M	285.7M	285.5M	285.6M	285.5M	299.1M	272.0M	569.4M	0.0M
659_eeB-T1-TRNA-1_B23MHV2LT4_1	0.3M	0.0M	0.0M	0.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_egp-T1-TRNA-1_B23MHV2LT4_1	0.2M	0.0M	0.0M	0.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_end-T1-TRNA-1_B23MHV2LT4_1	627.9M	0.0M	0.0M	33.1M	3.8M	574.6M	287.4M	287.2M	287.4M	287.3M	282.8M	291.8M	572.9M	0.0M
659_epG-T1-TRNA-1_B23MHV2LT4_1	664.7M	0.0M	0.0M	70.8M	4.1M	559.1M	279.7M	279.4M	279.6M	279.5M	301.8M	257.3M	557.4M	0.0M
659_epP-T1-TRNA-1_B23MHV2LT4_1	653.6M	0.0M	0.0M	59.4M	4.1M	564.0M	282.2M	281.8M	282.1M	282.0M	290.5M	273.5M	561.9M	0.0M
659_epZ-T1-TRNA-1_B23MHV2LT4_1	650.7M	0.0M	0.0M	58.1M	4.5M	565.2M	282.8M	282.4M	282.7M	282.5M	296.5M	268.7M	563.0M	0.0M
659_eu1-T1-TRNA-1_B23MHV2LT4_1	303.1M	0.0M	0.0M	30.8M	2.7M	257.4M	128.8M	128.6M	128.7M	128.7M	163.0M	94.4M	256.6M	0.0M
659_ezg-T1-TRNA-1_B23MHV2LT4_1	639.0M	0.0M	0.0M	44.4M	3.5M	572.0M	286.1M	285.9M	286.1M	285.9M	286.0M	286.0M	570.1M	0.0M
659_gK-T1-TRNA-1_B23MHV2LT4_1	647.8M	0.0M	0.0M	55.1M	3.4M	562.7M	281.5M	281.2M	281.4M	281.3M	286.9M	275.7M	560.9M	0.0M
659_mK-T1-TRNA-2_B23MHV2LT4_1	618.2M	0.0M	0.0M	57.3M	4.7M	532.5M	266.5M	266.1M	266.3M	266.2M	324.3M	208.2M	530.8M	0.0M
659_rd-T1-TRNA-1_B23MHV2LT4_1	442.0M	0.0M	0.0M	21.9M	1.9M	408.4M	204.3M	204.1M	204.2M	204.2M	201.5M	206.9M	406.8M	0.0M
659_ri-T1-TRNA-1_B23MHV2LT4_1	364.0M	0.0M	0.0M	32.6M	2.5M	316.1M	158.1M	158.0M	158.1M	158.0M	200.6M	115.4M	315.2M	0.0M
659_wQ-T1-TRNA-1_B23MHV2LT4_1	629.2M	0.0M	0.0M	36.7M	3.4M	573.3M	286.9M	286.4M	286.8M	286.5M	277.7M	295.7M	571.4M	0.0M
659_zO-T1-TRNA-1_B23MHV2LT4_1	639.1M	0.0M	0.0M	44.5M	3.5M	570.9M	285.5M	285.3M	285.5M	285.4M	312.4M	258.4M	569.4M	0.0M
FFPE_HD789_02_RNA_0014_B23MHV2LT4_1	638.8M	0.0M	0.0M	46.2M	3.5M	569.7M	285.0M	284.7M	284.9M	284.8M	283.0M	286.7M	568.0M	0.0M
FFPE_HD789_02_RNA_0015_B23MHV2LT4_1	636.1M	0.0M	0.0M	42.1M	3.4M	572.8M	286.5M	286.3M	286.4M	286.4M	270.0M	302.8M	571.1M	0.0M
FFPE_V4_0001_RNA_0003_B23MHV2LT4_1	635.1M	0.0M	0.0M	42.1M	3.6M	570.2M	285.3M	285.0M	285.2M	285.1M	274.6M	295.6M	568.3M	0.0M
FFPE_V4_0001_RNA_0003_B23MHV2LT4_2	633.5M	0.0M	0.0M	39.1M	3.5M	572.8M	286.5M	286.4M	286.4M	286.4M	268.9M	303.9M	570.9M	0.0M
NTC_0001_0001_B23MHV2LT4_1	0.2M	0.0M	0.0M	0.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
NTC_0001_0001_B23MHV2LT4_2	0.7M	0.0M	0.0M	0.2M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	192	277507082	0.2763%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	72	44552	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	66	36996	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	46	11227	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	37	15909	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	37	16126	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	36	6517	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	36	6587	0.0000%
GCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	36	4439	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGC	36	4486	0.0000%
CCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	34	3534	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGG	34	3606	0.0000%
CCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	31	2351	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGG	31	2387	0.0000%
GGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG	31	2056	0.0000%
CCACCACCACACCACCACCACCACCACCACCACCACCACCACCACCACCA	31	2778	0.0000%
GGGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	30	15801	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCCC	30	15941	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGG	27	2801	0.0000%
CCCGAGTGTTACAGCCCCCCCGGCAGCAGC	27	2824	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	96	108103663	0.2590%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	38	19943	0.0000%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	38	22591	0.0001%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	37	15909	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	37	16126	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	37	7895	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	36	6517	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	36	6587	0.0000%
GCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	36	4439	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGC	36	4486	0.0000%
CCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	34	3534	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGG	34	3606	0.0000%
CCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	31	2351	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGG	31	2387	0.0000%
GGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG	31	2056	0.0000%
GGGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	30	15801	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCCC	30	15941	0.0000%
CCACCACCACACCACCACCACCACCACCACCACCACCACCACCACCACCA	30	2505	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGG	27	2801	0.0000%
CCCGAGTGTTACAGCCCCCCCGGCAGCAGC	27	2824	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER	filter_arriba_main.py	`1.0`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CONTAMINATION_SKIPPED_LOW_READS	contamination_skipped_low_reads	`1.0.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PICARD_COLLECTINSERTSIZEMETRICS	picard	`3.1.0`
PICARD_COLLECTRNASEQMETRICS	picard	`null`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
SAMTOOLS_INDEX_ALIGNMENT_CRAM	samtools	`1.17`
SAMTOOLS_INDEX_STAR_ALIGNMENT	samtools	`1.17`
SAMTOOLS_VIEW_ALIGNMENT_CRAM	samtools	`1.17`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	boto3	`unknown`
	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_ALIGNMENT	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.0`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`3.0.2`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run /code/main.nf -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0009_exp0010/B23MHV2LT4/nfcore_rnafusion__04da504a--20260522-114016' --project-dir /Users/anaik/Documents/Altera/rnafusion -profile docker,eks,std_run -name dev_rna_exp09_10-04da504a --flowcell_id 20260226_LH00995_0015_B23MHV2LT4 --rundir 's3://natera-labdata-rnd-dev-s3/illumina/20260226_LH00995_0015_B23MHV2LT4' --bclconvert_samplesheet 's3://natera-labdata-rnd-dev-s3/illumina/20260226_LH00995_0015_B23MHV2LT4/bclconvert_samplesheet.csv' --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0009_exp0010/B23MHV2LT4/nfcore_rnafusion__04da504a--20260522-114016'

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp09_10-04da504a
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /code
userName: nextflow
profile: docker,eks,std_run
configFiles: N/A

Input/output options

outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0009_exp0010/B23MHV2LT4/nfcore_rnafusion__04da504a--20260522-114016
rundir: s3://natera-labdata-rnd-dev-s3/illumina/20260226_LH00995_0015_B23MHV2LT4
flowcell_id: 20260226_LH00995_0015_B23MHV2LT4
strand: reverse
bclconvert_samplesheet: s3://natera-labdata-rnd-dev-s3/illumina/20260226_LH00995_0015_B23MHV2LT4/bclconvert_samplesheet.csv
infer_sample_type_map: true
sample_type_map_positive_substring: HD789
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
arriba_gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir//ref_annot.gtf
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
starindex_ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
fastp_reads_to_process: 300000000
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Insert Size

Mark Duplicates Help

RnaSeqMetrics Assignment

Gene Coverage

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks