Detecting adapter sequence for read1...
>Nextera_LMP_Read1_External_Adapter | >Illumina Multiplexing Index Sequencing Primer
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 285607
total bases: 43126657
Q20 bases: 38432504(89.1154%)
Q30 bases: 30782155(71.3762%)

Read2 before filtering:
total reads: 285607
total bases: 43126657
Q20 bases: 39107065(90.6796%)
Q30 bases: 28388548(65.826%)

Read1 after filtering:
total reads: 37008
total bases: 1816453
Q20 bases: 1763819(97.1024%)
Q30 bases: 1648070(90.7301%)

Read2 after filtering:
total reads: 37008
total bases: 1890270
Q20 bases: 1846832(97.702%)
Q30 bases: 1725853(91.3019%)

Filtering result:
reads passed filter: 74016
reads failed due to low quality: 45378
reads failed due to too many N: 0
reads failed due to too short: 451820
reads with adapter trimmed: 315433
bases trimmed due to adapters: 44024720

Duplication rate: 57.3964%

Insert size peak (evaluated by paired-end reads): 36

JSON report: 659_8h-T1-TRNA-1_B23MHV2LT4_1.fastp.json
HTML report: 659_8h-T1-TRNA-1_B23MHV2LT4_1.fastp.html

fastp --in1 659_8h-T1-TRNA-1_B23MHV2LT4_1_1.fastq.gz --in2 659_8h-T1-TRNA-1_B23MHV2LT4_1_2.fastq.gz --out1 659_8h-T1-TRNA-1_B23MHV2LT4_1_1.fastp.fastq.gz --out2 659_8h-T1-TRNA-1_B23MHV2LT4_1_2.fastp.fastq.gz --json 659_8h-T1-TRNA-1_B23MHV2LT4_1.fastp.json --html 659_8h-T1-TRNA-1_B23MHV2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 2 seconds