Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 3433034
total bases: 518388134
Q20 bases: 508178902(98.0306%)
Q30 bases: 485904656(93.7338%)

Read2 before filtering:
total reads: 3433034
total bases: 518388134
Q20 bases: 505554473(97.5243%)
Q30 bases: 476005382(91.8241%)

Read1 after filtering:
total reads: 3093294
total bases: 410439212
Q20 bases: 408500111(99.5276%)
Q30 bases: 399817255(97.4121%)

Read2 after filtering:
total reads: 3093294
total bases: 410924373
Q20 bases: 407736622(99.2242%)
Q30 bases: 396381586(96.461%)

Filtering result:
reads passed filter: 6186588
reads failed due to low quality: 140940
reads failed due to too many N: 1304
reads failed due to too short: 537236
reads with adapter trimmed: 3083396
bases trimmed due to adapters: 123307907

Duplication rate: 62.7827%

Insert size peak (evaluated by paired-end reads): 119

JSON report: 659_Kh-T1-TRNA-1_B23MHV2LT4_1.fastp.json
HTML report: 659_Kh-T1-TRNA-1_B23MHV2LT4_1.fastp.html

fastp --in1 659_Kh-T1-TRNA-1_B23MHV2LT4_1_1.fastq.gz --in2 659_Kh-T1-TRNA-1_B23MHV2LT4_1_2.fastq.gz --out1 659_Kh-T1-TRNA-1_B23MHV2LT4_1_1.fastp.fastq.gz --out2 659_Kh-T1-TRNA-1_B23MHV2LT4_1_2.fastp.fastq.gz --json 659_Kh-T1-TRNA-1_B23MHV2LT4_1.fastp.json --html 659_Kh-T1-TRNA-1_B23MHV2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 9 seconds