Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 364298
total bases: 55008998
Q20 bases: 47020238(85.4774%)
Q30 bases: 35018174(63.659%)

Read2 before filtering:
total reads: 364298
total bases: 55008998
Q20 bases: 50486852(91.7793%)
Q30 bases: 35590026(64.6986%)

Read1 after filtering:
total reads: 30487
total bases: 1706929
Q20 bases: 1628578(95.4098%)
Q30 bases: 1488790(87.2204%)

Read2 after filtering:
total reads: 30487
total bases: 1797600
Q20 bases: 1747349(97.2046%)
Q30 bases: 1600330(89.0259%)

Filtering result:
reads passed filter: 60974
reads failed due to low quality: 44706
reads failed due to too many N: 2
reads failed due to too short: 622914
reads with adapter trimmed: 386474
bases trimmed due to adapters: 16577051

Duplication rate: 49.1213%

Insert size peak (evaluated by paired-end reads): 35

JSON report: 659_Wm-T1-TRNA-1_B23MHV2LT4_1.fastp.json
HTML report: 659_Wm-T1-TRNA-1_B23MHV2LT4_1.fastp.html

fastp --in1 659_Wm-T1-TRNA-1_B23MHV2LT4_1_1.fastq.gz --in2 659_Wm-T1-TRNA-1_B23MHV2LT4_1_2.fastq.gz --out1 659_Wm-T1-TRNA-1_B23MHV2LT4_1_1.fastp.fastq.gz --out2 659_Wm-T1-TRNA-1_B23MHV2LT4_1_2.fastp.fastq.gz --json 659_Wm-T1-TRNA-1_B23MHV2LT4_1.fastp.json --html 659_Wm-T1-TRNA-1_B23MHV2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 3 seconds