Detecting adapter sequence for read1...
>Nextera_LMP_Read1_External_Adapter | >Illumina Multiplexing Index Sequencing Primer
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 437890
total bases: 66121390
Q20 bases: 57505424(86.9695%)
Q30 bases: 44494713(67.2925%)

Read2 before filtering:
total reads: 437890
total bases: 66121390
Q20 bases: 58823637(88.9631%)
Q30 bases: 42302021(63.9763%)

Read1 after filtering:
total reads: 37961
total bases: 1937887
Q20 bases: 1869552(96.4737%)
Q30 bases: 1732080(89.3798%)

Read2 after filtering:
total reads: 37961
total bases: 2033547
Q20 bases: 1987674(97.7442%)
Q30 bases: 1854492(91.1949%)

Filtering result:
reads passed filter: 75922
reads failed due to low quality: 93510
reads failed due to too many N: 0
reads failed due to too short: 706348
reads with adapter trimmed: 467147
bases trimmed due to adapters: 66156255

Duplication rate: 49.683%

Insert size peak (evaluated by paired-end reads): 36

JSON report: 659_b6o-T1-TRNA-1_B23MHV2LT4_1.fastp.json
HTML report: 659_b6o-T1-TRNA-1_B23MHV2LT4_1.fastp.html

fastp --in1 659_b6o-T1-TRNA-1_B23MHV2LT4_1_1.fastq.gz --in2 659_b6o-T1-TRNA-1_B23MHV2LT4_1_2.fastq.gz --out1 659_b6o-T1-TRNA-1_B23MHV2LT4_1_1.fastp.fastq.gz --out2 659_b6o-T1-TRNA-1_B23MHV2LT4_1_2.fastp.fastq.gz --json 659_b6o-T1-TRNA-1_B23MHV2LT4_1.fastp.json --html 659_b6o-T1-TRNA-1_B23MHV2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 2 seconds