Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 319430
total bases: 48233930
Q20 bases: 41140927(85.2946%)
Q30 bases: 30840163(63.9387%)

Read2 before filtering:
total reads: 319430
total bases: 48233930
Q20 bases: 43158316(89.4771%)
Q30 bases: 30349672(62.9218%)

Read1 after filtering:
total reads: 39483
total bases: 2055639
Q20 bases: 1968217(95.7472%)
Q30 bases: 1813168(88.2046%)

Read2 after filtering:
total reads: 39483
total bases: 2140509
Q20 bases: 2075852(96.9794%)
Q30 bases: 1927708(90.0584%)

Filtering result:
reads passed filter: 78966
reads failed due to low quality: 58974
reads failed due to too many N: 2
reads failed due to too short: 500918
reads with adapter trimmed: 351090
bases trimmed due to adapters: 16858037

Duplication rate: 38.3843%

Insert size peak (evaluated by paired-end reads): 35

JSON report: 659_buj-T1-TRNA-1_B23MHV2LT4_1.fastp.json
HTML report: 659_buj-T1-TRNA-1_B23MHV2LT4_1.fastp.html

fastp --in1 659_buj-T1-TRNA-1_B23MHV2LT4_1_1.fastq.gz --in2 659_buj-T1-TRNA-1_B23MHV2LT4_1_2.fastq.gz --out1 659_buj-T1-TRNA-1_B23MHV2LT4_1_1.fastp.fastq.gz --out2 659_buj-T1-TRNA-1_B23MHV2LT4_1_2.fastp.fastq.gz --json 659_buj-T1-TRNA-1_B23MHV2LT4_1.fastp.json --html 659_buj-T1-TRNA-1_B23MHV2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 4 seconds