Detecting adapter sequence for read1...
>Nextera_LMP_Read1_External_Adapter | >Illumina Multiplexing Index Sequencing Primer
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 332597
total bases: 50222147
Q20 bases: 47426833(94.4341%)
Q30 bases: 41433336(82.5001%)

Read2 before filtering:
total reads: 332597
total bases: 50222147
Q20 bases: 47212428(94.0072%)
Q30 bases: 37316468(74.3028%)

Read1 after filtering:
total reads: 20937
total bases: 1371159
Q20 bases: 1338886(97.6463%)
Q30 bases: 1259509(91.8573%)

Read2 after filtering:
total reads: 20937
total bases: 1417019
Q20 bases: 1390009(98.0939%)
Q30 bases: 1305829(92.1532%)

Filtering result:
reads passed filter: 41874
reads failed due to low quality: 36870
reads failed due to too many N: 0
reads failed due to too short: 586450
reads with adapter trimmed: 345847
bases trimmed due to adapters: 49199857

Duplication rate: 78.4718%

Insert size peak (evaluated by paired-end reads): 36

JSON report: 659_cAa-T1-TRNA-1_B23MHV2LT4_1.fastp.json
HTML report: 659_cAa-T1-TRNA-1_B23MHV2LT4_1.fastp.html

fastp --in1 659_cAa-T1-TRNA-1_B23MHV2LT4_1_1.fastq.gz --in2 659_cAa-T1-TRNA-1_B23MHV2LT4_1_2.fastq.gz --out1 659_cAa-T1-TRNA-1_B23MHV2LT4_1_1.fastp.fastq.gz --out2 659_cAa-T1-TRNA-1_B23MHV2LT4_1_2.fastp.fastq.gz --json 659_cAa-T1-TRNA-1_B23MHV2LT4_1.fastp.json --html 659_cAa-T1-TRNA-1_B23MHV2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 3 seconds