Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 292068
total bases: 44102268
Q20 bases: 37683600(85.4459%)
Q30 bases: 28222132(63.9925%)

Read2 before filtering:
total reads: 292068
total bases: 44102268
Q20 bases: 41275085(93.5895%)
Q30 bases: 31683472(71.8409%)

Read1 after filtering:
total reads: 34213
total bases: 1689216
Q20 bases: 1614162(95.5569%)
Q30 bases: 1475266(87.3344%)

Read2 after filtering:
total reads: 34213
total bases: 1757093
Q20 bases: 1721947(97.9998%)
Q30 bases: 1618742(92.1261%)

Filtering result:
reads passed filter: 68426
reads failed due to low quality: 32018
reads failed due to too many N: 0
reads failed due to too short: 483692
reads with adapter trimmed: 319901
bases trimmed due to adapters: 15305296

Duplication rate: 48.0039%

Insert size peak (evaluated by paired-end reads): 36

JSON report: 659_cq5-T1-TRNA-1_B23MHV2LT4_1.fastp.json
HTML report: 659_cq5-T1-TRNA-1_B23MHV2LT4_1.fastp.html

fastp --in1 659_cq5-T1-TRNA-1_B23MHV2LT4_1_1.fastq.gz --in2 659_cq5-T1-TRNA-1_B23MHV2LT4_1_2.fastq.gz --out1 659_cq5-T1-TRNA-1_B23MHV2LT4_1_1.fastp.fastq.gz --out2 659_cq5-T1-TRNA-1_B23MHV2LT4_1_2.fastp.fastq.gz --json 659_cq5-T1-TRNA-1_B23MHV2LT4_1.fastp.json --html 659_cq5-T1-TRNA-1_B23MHV2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 3 seconds