Detecting adapter sequence for read1...
>Nextera_LMP_Read1_External_Adapter | >Illumina Multiplexing Index Sequencing Primer
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 395877
total bases: 59777427
Q20 bases: 55871323(93.4656%)
Q30 bases: 47969173(80.2463%)

Read2 before filtering:
total reads: 395877
total bases: 59777427
Q20 bases: 56014796(93.7056%)
Q30 bases: 43243337(72.3406%)

Read1 after filtering:
total reads: 39193
total bases: 2143961
Q20 bases: 2088800(97.4271%)
Q30 bases: 1955599(91.2143%)

Read2 after filtering:
total reads: 39193
total bases: 2227113
Q20 bases: 2181441(97.9493%)
Q30 bases: 2044912(91.819%)

Filtering result:
reads passed filter: 78386
reads failed due to low quality: 42734
reads failed due to too many N: 4
reads failed due to too short: 670630
reads with adapter trimmed: 425373
bases trimmed due to adapters: 59828303

Duplication rate: 75.0503%

Insert size peak (evaluated by paired-end reads): 36

JSON report: 659_d0M-T1-TRNA-1_B23MHV2LT4_1.fastp.json
HTML report: 659_d0M-T1-TRNA-1_B23MHV2LT4_1.fastp.html

fastp --in1 659_d0M-T1-TRNA-1_B23MHV2LT4_1_1.fastq.gz --in2 659_d0M-T1-TRNA-1_B23MHV2LT4_1_2.fastq.gz --out1 659_d0M-T1-TRNA-1_B23MHV2LT4_1_1.fastp.fastq.gz --out2 659_d0M-T1-TRNA-1_B23MHV2LT4_1_2.fastp.fastq.gz --json 659_d0M-T1-TRNA-1_B23MHV2LT4_1.fastp.json --html 659_d0M-T1-TRNA-1_B23MHV2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 3 seconds