Detecting adapter sequence for read1...
>Nextera_LMP_Read1_External_Adapter | >Illumina Multiplexing Index Sequencing Primer
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 367467
total bases: 55487517
Q20 bases: 48127569(86.7358%)
Q30 bases: 37243336(67.1202%)

Read2 before filtering:
total reads: 367467
total bases: 55487517
Q20 bases: 52028738(93.7666%)
Q30 bases: 40120533(72.3055%)

Read1 after filtering:
total reads: 44782
total bases: 2154808
Q20 bases: 2079550(96.5074%)
Q30 bases: 1929189(89.5295%)

Read2 after filtering:
total reads: 44782
total bases: 2263844
Q20 bases: 2208896(97.5728%)
Q30 bases: 2065428(91.2354%)

Filtering result:
reads passed filter: 89564
reads failed due to low quality: 34530
reads failed due to too many N: 2
reads failed due to too short: 610838
reads with adapter trimmed: 404136
bases trimmed due to adapters: 56380679

Duplication rate: 54.7451%

Insert size peak (evaluated by paired-end reads): 36

JSON report: 659_d0V-T1-TRNA-1_B23MHV2LT4_1.fastp.json
HTML report: 659_d0V-T1-TRNA-1_B23MHV2LT4_1.fastp.html

fastp --in1 659_d0V-T1-TRNA-1_B23MHV2LT4_1_1.fastq.gz --in2 659_d0V-T1-TRNA-1_B23MHV2LT4_1_2.fastq.gz --out1 659_d0V-T1-TRNA-1_B23MHV2LT4_1_1.fastp.fastq.gz --out2 659_d0V-T1-TRNA-1_B23MHV2LT4_1_2.fastp.fastq.gz --json 659_d0V-T1-TRNA-1_B23MHV2LT4_1.fastp.json --html 659_d0V-T1-TRNA-1_B23MHV2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 2 seconds