Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 353103
total bases: 53318553
Q20 bases: 45567467(85.4627%)
Q30 bases: 33948437(63.671%)

Read2 before filtering:
total reads: 353103
total bases: 53318553
Q20 bases: 49633937(93.0894%)
Q30 bases: 37591313(70.5033%)

Read1 after filtering:
total reads: 36535
total bases: 2707046
Q20 bases: 2626673(97.031%)
Q30 bases: 2471867(91.3123%)

Read2 after filtering:
total reads: 36535
total bases: 2787877
Q20 bases: 2737077(98.1778%)
Q30 bases: 2593468(93.0266%)

Filtering result:
reads passed filter: 73070
reads failed due to low quality: 37808
reads failed due to too many N: 2
reads failed due to too short: 595326
reads with adapter trimmed: 376810
bases trimmed due to adapters: 15817728

Duplication rate: 45.651%

Insert size peak (evaluated by paired-end reads): 35

JSON report: 659_dQk-T1-TRNA-1_B23MHV2LT4_1.fastp.json
HTML report: 659_dQk-T1-TRNA-1_B23MHV2LT4_1.fastp.html

fastp --in1 659_dQk-T1-TRNA-1_B23MHV2LT4_1_1.fastq.gz --in2 659_dQk-T1-TRNA-1_B23MHV2LT4_1_2.fastq.gz --out1 659_dQk-T1-TRNA-1_B23MHV2LT4_1_1.fastp.fastq.gz --out2 659_dQk-T1-TRNA-1_B23MHV2LT4_1_2.fastp.fastq.gz --json 659_dQk-T1-TRNA-1_B23MHV2LT4_1.fastp.json --html 659_dQk-T1-TRNA-1_B23MHV2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 3 seconds