File Info

Filename
659_dkd-T1-TRNA-1_B23MHV2LT4_1.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0009_exp0010/B23MHV2LT4/nfcore_rnafusion__3b7a596a--20260604-122713/fastp/659_dkd-T1-TRNA-1_B23MHV2LT4_1.fastp.log
Size
1.5 KB
Published
Jun 04, 2026 1:15 PM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 184741
total bases: 27895891
Q20 bases: 23701296(84.9634%)
Q30 bases: 17022907(61.023%)

Read2 before filtering:
total reads: 184741
total bases: 27895891
Q20 bases: 26367164(94.5199%)
Q30 bases: 21029873(75.387%)

Read1 after filtering:
total reads: 28028
total bases: 1262068
Q20 bases: 1225869(97.1318%)
Q30 bases: 1144616(90.6937%)

Read2 after filtering:
total reads: 28028
total bases: 1335365
Q20 bases: 1308155(97.9624%)
Q30 bases: 1232025(92.2613%)

Filtering result:
reads passed filter: 56056
reads failed due to low quality: 13988
reads failed due to too many N: 0
reads failed due to too short: 299438
reads with adapter trimmed: 208697
bases trimmed due to adapters: 10999673

Duplication rate: 42.5174%

Insert size peak (evaluated by paired-end reads): 36

JSON report: 659_dkd-T1-TRNA-1_B23MHV2LT4_1.fastp.json
HTML report: 659_dkd-T1-TRNA-1_B23MHV2LT4_1.fastp.html

fastp --in1 659_dkd-T1-TRNA-1_B23MHV2LT4_1_1.fastq.gz --in2 659_dkd-T1-TRNA-1_B23MHV2LT4_1_2.fastq.gz --out1 659_dkd-T1-TRNA-1_B23MHV2LT4_1_1.fastp.fastq.gz --out2 659_dkd-T1-TRNA-1_B23MHV2LT4_1_2.fastp.fastq.gz --json 659_dkd-T1-TRNA-1_B23MHV2LT4_1.fastp.json --html 659_dkd-T1-TRNA-1_B23MHV2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 2 seconds