Detecting adapter sequence for read1...
>Nextera_LMP_Read1_External_Adapter | >Illumina Multiplexing Index Sequencing Primer
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 543963
total bases: 82138413
Q20 bases: 77140048(93.9147%)
Q30 bases: 66695255(81.1986%)

Read2 before filtering:
total reads: 543963
total bases: 82138413
Q20 bases: 77107390(93.8749%)
Q30 bases: 61179319(74.4832%)

Read1 after filtering:
total reads: 81599
total bases: 3663261
Q20 bases: 3584139(97.8401%)
Q30 bases: 3377149(92.1897%)

Read2 after filtering:
total reads: 81599
total bases: 3843126
Q20 bases: 3769277(98.0784%)
Q30 bases: 3569162(92.8713%)

Filtering result:
reads passed filter: 163198
reads failed due to low quality: 55980
reads failed due to too many N: 10
reads failed due to too short: 868738
reads with adapter trimmed: 613789
bases trimmed due to adapters: 84823478

Duplication rate: 73.7013%

Insert size peak (evaluated by paired-end reads): 36

JSON report: 659_dwi-T1-TRNA-1_B23MHV2LT4_1.fastp.json
HTML report: 659_dwi-T1-TRNA-1_B23MHV2LT4_1.fastp.html

fastp --in1 659_dwi-T1-TRNA-1_B23MHV2LT4_1_1.fastq.gz --in2 659_dwi-T1-TRNA-1_B23MHV2LT4_1_2.fastq.gz --out1 659_dwi-T1-TRNA-1_B23MHV2LT4_1_1.fastp.fastq.gz --out2 659_dwi-T1-TRNA-1_B23MHV2LT4_1_2.fastp.fastq.gz --json 659_dwi-T1-TRNA-1_B23MHV2LT4_1.fastp.json --html 659_dwi-T1-TRNA-1_B23MHV2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 3 seconds