Detecting adapter sequence for read1...
>Nextera_LMP_Read1_External_Adapter | >Illumina Multiplexing Index Sequencing Primer
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 233173
total bases: 35209123
Q20 bases: 30502048(86.6311%)
Q30 bases: 23505552(66.7598%)

Read2 before filtering:
total reads: 233173
total bases: 35209123
Q20 bases: 33152710(94.1594%)
Q30 bases: 25349096(71.9958%)

Read1 after filtering:
total reads: 12222
total bases: 921591
Q20 bases: 880938(95.5888%)
Q30 bases: 811983(88.1067%)

Read2 after filtering:
total reads: 12222
total bases: 939009
Q20 bases: 916377(97.5898%)
Q30 bases: 851511(90.6819%)

Filtering result:
reads passed filter: 24444
reads failed due to low quality: 20510
reads failed due to too many N: 4
reads failed due to too short: 421388
reads with adapter trimmed: 239853
bases trimmed due to adapters: 34402585

Duplication rate: 56.8239%

Insert size peak (evaluated by paired-end reads): 35

JSON report: 659_e0S-T1-TRNA-1_B23MHV2LT4_1.fastp.json
HTML report: 659_e0S-T1-TRNA-1_B23MHV2LT4_1.fastp.html

fastp --in1 659_e0S-T1-TRNA-1_B23MHV2LT4_1_1.fastq.gz --in2 659_e0S-T1-TRNA-1_B23MHV2LT4_1_2.fastq.gz --out1 659_e0S-T1-TRNA-1_B23MHV2LT4_1_1.fastp.fastq.gz --out2 659_e0S-T1-TRNA-1_B23MHV2LT4_1_2.fastp.fastq.gz --json 659_e0S-T1-TRNA-1_B23MHV2LT4_1.fastp.json --html 659_e0S-T1-TRNA-1_B23MHV2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 2 seconds