Detecting adapter sequence for read1...
>Nextera_LMP_Read1_External_Adapter | >Illumina Multiplexing Index Sequencing Primer
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 397977
total bases: 60094527
Q20 bases: 55118792(91.7202%)
Q30 bases: 45906122(76.3899%)

Read2 before filtering:
total reads: 397977
total bases: 60094527
Q20 bases: 55820069(92.8871%)
Q30 bases: 41610139(69.2411%)

Read1 after filtering:
total reads: 38663
total bases: 2017851
Q20 bases: 1961198(97.1924%)
Q30 bases: 1832922(90.8353%)

Read2 after filtering:
total reads: 38663
total bases: 2115086
Q20 bases: 2069816(97.8597%)
Q30 bases: 1931560(91.323%)

Filtering result:
reads passed filter: 77326
reads failed due to low quality: 47874
reads failed due to too many N: 6
reads failed due to too short: 670748
reads with adapter trimmed: 427427
bases trimmed due to adapters: 60143350

Duplication rate: 69.8334%

Insert size peak (evaluated by paired-end reads): 36

JSON report: 659_eKx-T1-TRNA-1_B23MHV2LT4_1.fastp.json
HTML report: 659_eKx-T1-TRNA-1_B23MHV2LT4_1.fastp.html

fastp --in1 659_eKx-T1-TRNA-1_B23MHV2LT4_1_1.fastq.gz --in2 659_eKx-T1-TRNA-1_B23MHV2LT4_1_2.fastq.gz --out1 659_eKx-T1-TRNA-1_B23MHV2LT4_1_1.fastp.fastq.gz --out2 659_eKx-T1-TRNA-1_B23MHV2LT4_1_2.fastp.fastq.gz --json 659_eKx-T1-TRNA-1_B23MHV2LT4_1.fastp.json --html 659_eKx-T1-TRNA-1_B23MHV2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 2 seconds