File Info

Filename
659_eeB-T1-TRNA-1_B23MHV2LT4_1.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0009_exp0010/B23MHV2LT4/nfcore_rnafusion__3b7a596a--20260604-122713/fastp/659_eeB-T1-TRNA-1_B23MHV2LT4_1.fastp.log
Size
1.5 KB
Published
Jun 04, 2026 1:15 PM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 205713
total bases: 31062663
Q20 bases: 26447973(85.1439%)
Q30 bases: 19536191(62.8928%)

Read2 before filtering:
total reads: 205713
total bases: 31062663
Q20 bases: 29200080(94.0038%)
Q30 bases: 22075157(71.0665%)

Read1 after filtering:
total reads: 19166
total bases: 1129331
Q20 bases: 1073024(95.0141%)
Q30 bases: 972557(86.118%)

Read2 after filtering:
total reads: 19166
total bases: 1176242
Q20 bases: 1140571(96.9674%)
Q30 bases: 1056860(89.8506%)

Filtering result:
reads passed filter: 38332
reads failed due to low quality: 17604
reads failed due to too many N: 2
reads failed due to too short: 355488
reads with adapter trimmed: 219906
bases trimmed due to adapters: 9542631

Duplication rate: 48.292%

Insert size peak (evaluated by paired-end reads): 36

JSON report: 659_eeB-T1-TRNA-1_B23MHV2LT4_1.fastp.json
HTML report: 659_eeB-T1-TRNA-1_B23MHV2LT4_1.fastp.html

fastp --in1 659_eeB-T1-TRNA-1_B23MHV2LT4_1_1.fastq.gz --in2 659_eeB-T1-TRNA-1_B23MHV2LT4_1_2.fastq.gz --out1 659_eeB-T1-TRNA-1_B23MHV2LT4_1_1.fastp.fastq.gz --out2 659_eeB-T1-TRNA-1_B23MHV2LT4_1_2.fastp.fastq.gz --json 659_eeB-T1-TRNA-1_B23MHV2LT4_1.fastp.json --html 659_eeB-T1-TRNA-1_B23MHV2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 3 seconds