Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 197292
total bases: 29791092
Q20 bases: 25771623(86.5078%)
Q30 bases: 19847103(66.6209%)

Read2 before filtering:
total reads: 197292
total bases: 29791092
Q20 bases: 28078564(94.2515%)
Q30 bases: 21562994(72.3807%)

Read1 after filtering:
total reads: 11970
total bases: 718953
Q20 bases: 680757(94.6873%)
Q30 bases: 616130(85.6982%)

Read2 after filtering:
total reads: 11970
total bases: 746641
Q20 bases: 726211(97.2637%)
Q30 bases: 665584(89.1438%)

Filtering result:
reads passed filter: 23940
reads failed due to low quality: 15192
reads failed due to too many N: 0
reads failed due to too short: 355452
reads with adapter trimmed: 205166
bases trimmed due to adapters: 8161275

Duplication rate: 53.4061%

Insert size peak (evaluated by paired-end reads): 36

JSON report: 659_egp-T1-TRNA-1_B23MHV2LT4_1.fastp.json
HTML report: 659_egp-T1-TRNA-1_B23MHV2LT4_1.fastp.html

fastp --in1 659_egp-T1-TRNA-1_B23MHV2LT4_1_1.fastq.gz --in2 659_egp-T1-TRNA-1_B23MHV2LT4_1_2.fastq.gz --out1 659_egp-T1-TRNA-1_B23MHV2LT4_1_1.fastp.fastq.gz --out2 659_egp-T1-TRNA-1_B23MHV2LT4_1_2.fastp.fastq.gz --json 659_egp-T1-TRNA-1_B23MHV2LT4_1.fastp.json --html 659_egp-T1-TRNA-1_B23MHV2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 2 seconds